Biotechnology and Biochemistry

Department of Biotechnology and Biochemistry

Department of Biotechnology published whole genome sequence of sclerotium rolfssi (Groundnut stem rot) First time in the world

Professor &Head : Dr. H. P. Gajera, Ph.D.

Contacts : 0091-285-2672080-90-379 (Office)

: E-mail: This email address is being protected from spambots. You need JavaScript enabled to view it.

Faculty Strength (Current Position)

Sr. No.	Name	Designation	Higher Qualification	Experience (Years)
1.	Dr. H. P. Gajera	I/C Professor and Head	Ph. D.	28
2.	Dr. U. K. Kandoliya	Associate Professor	Ph. D.	28
3.	Dr. M. V. Parakhia	Assistant Professor	Ph.D.	14
4.	Dr. S. B. Bhatt	Assistant Professor	Ph. D.	08
5.	Dr. A. G. Vala	Assistant Professor	Ph. D.	08
6.	Dr. P. J. Rathod	Assistant Professor	Ph. D.	12

Technical Staff (Current Position)

Sr. No.	Name	Designation	Qualification	Experience (Years)
1.	Mr. N. A. Patel	Agril. Officer	M.Sc. (Agri.)	08
2.	Mr. A. R. Japda	Agril. Officer	M.Sc. (Agri.)	05
3.	Miss. J. K. Manavar	Lab.Technician	M.Sc. (Home science)	13
4.	Miss. N. S. Vaghani	Lab.Technician	M.Sc. (Chemistry)	13
5.	Mr. H. Z. Hirpara	Lab.Technician	M.Sc. (Chemistry)	13
6.	Mr. V. G. Vyas	Lab.Technician	M. Sc. (Chemistry)	13
7.	Mr. V. K. Bajaniya	Lab.Technician	M.Sc. (Chemistry)	13
8.	Mr. R. L. Bhalara	Lab.Technician	M. Sc. & DMLT	13
9.	Miss. S. V. Bharadava	Agril. Assistant	Polytech. in Agri.	02

Supporting Staff (Current Position)

Sr. No.	Name	Designation	Qualification	Experience
1.	Mr. A. N. Dabhi	Computer Programmer	M.C.A. & PGDCA	12
2.	Mr. D. M. Parmar	Sr. Clerk	B.Com.	12
3.	Mr. B. B. Patel	Store keeper	12th pass	05

Courses Offered at UG /PG and Others(Current Year Odd & Even Sem.)

(A) Post Graduate Courses

Teacher	Odd / Even	Course No.	Title of the course	Credit
PLANT MOLECULAR BIOLOGY AND BIOTECHNOLOGY
Dr. A. G. Vala	Odd	MBB-502	Fundamentals of Molecular Biology	3+0
Dr. S. B. Bhatt	Odd	MBB-503	Molecular Cell Biology	3+0
Dr. M. V. Parakhia	Odd	MBB-509	Techniques in Molecular Biology-II	0+3
Dr. M. V. Parakhia	Odd	MBB-508	Introduction to Bioinformatics	2+1
Dr. H. P. Gajera	Odd	MBB-601	Plant Molecular Biology	3+0
Dr. M. V. Parakhia	Odd	MBB-505	Omics insystem biology	2+1
Dr. S. Chandramohan**	Odd	MBB-602	Plant Genome engineering	3+0
Dr. H. P. Gajera	Even	MBB-514	Nano Biotechnology	2+1
Dr. U. K. Kandoliya	Even	MBB-512	Immunology and Molecular diagnosis	2+1
Dr. U. K. Kandoliya	Even	MBB-504	Techniques in Molecular Biology-I	0+3
Dr. H. P. Gajera	Even	MBB-501	Principles of Biotechnology	2+1
Dr. M. V. Parakhia	Even	MBB-603	Advances in Microbial Biotechnology	3+0
Dr. A. G. Vala	Even	MBB-606	Commercial Plant Tissue Culture	2+0
Biochemistry
Dr. H. P. Gajera	Odd	Biochem.-501	Basic Biochemistry	3+1
Dr. U. K. Kandoliya	Odd	Biochem.-506	Techniques in Biochemistry	2+2
Dr. S. B. Bhatt	Odd	Biochem.-506	Immunochemistry	2+1
Dr. P. J. Rathod	Odd	Biochem.-511	Biochemistry of Cereals, Oilseeds and Pulses	2+1
Dr. P. J. Rathod	Odd	Biochem.-509	Nutritional Biochemistry	2+1
Dr. H. P. Gajera	Odd	Biochem.-602	Advanced Molecular Biology	3+0
Dr. U. K. Kandoliya	Odd	Biochem.-603	Biochemistry of Biotic and Abiotic Stress	3+0
Dr. H. P. Gajera	Odd	Biochem.-505	Techniques in Biochemistry	1+2
Dr. P. J. Rathod	Odd	Biochem.-601	Advanced Enzymology	2+1
Dr. P. J. Rathod	Even	Biochem.-502	Intermediary Metabolism	3+0
Dr. P. J. Rathod	Even	Biochem.-606	Biomembrane	2+0
Dr. U. K. Kandoliya	Even	Biochem.-607	Advanced Techniques in Biochemistry	0+2
Dr. A. G. Vala	Even	Biochem-605	Concepts and Application of Omics In Biological Sciences	3+0
**Directorate of Groundnut Research, Ivnagar Road, Junagadh

(B) Under Graduate Programme,B.Sc. (Hons.) Agri.

Teacher	Odd / Even	Course No.	Title of the course	Credit
Dr. U. K. Kandoliya	Even	Biochem 2.1	Fundamentals of Plant Biochemistry	3 (2+1)
Dr. P. J. Rathod	Even	Biochem 2.1	Fundamentals of Plant Biochemistry	3 (2+1)
Dr. M. V. Parakhia	Even (Khapat)	Ag. Micro 6.2	Biopesticides and Biofetilizers	3 (2+1)
Dr. S. B. Bhatt	Even	Ag. Micro 6.2	Biopesticides and Biofetilizers	3 (2+1)
Dr. A. G. Vala	Odd (Khapat)	Biotech. 5.1	Introductory Biotechnology	3 (2+1)
Dr. M. V. Parakhia	Odd (Khapat)	Ag. Micro 1.1	Agricultural Microbiology	2 (1+1)
Dr. S. B. Bhatt	Odd	Ag. Micro 1.1	Agricultural Microbiology	2 (1+1)

(C) Under GraduateProgramme, B.Sc. (Hons.) Horti.

Teacher	Odd / Even	Course No.	Title of the course	Credit
Dr. U. K. Kandoliya	Odd	BSC.1.1	Elementary Plant Biochemistry	2(1+1)
Dr. P.J.Rathod	Odd	PHT.1.1	Fundamental of food science and nutrition	2(1+1)
Dr. A. G. Vala	Odd	BSC 3.6	Elementary Plant Biotechnology	2(1+1)

(D) Polytechnic / Agro Based ITI

Teacher	Odd / Even	Course No.	Title of the course	Credit
Dr. M. V. Parakhiya	Odd	Ag. Micro 5.1	Agril. Microbiology	2(1+1)
Mr. A. R. Zapda	Odd	BSC 5.7	Elementary Plant Biochemistry	2(1+1)

Laboratory Facility

Sr. No.	Name of Lab.	Seating Capacity	Purpose	UG or PG
1.	PG Laboratory	35	PG Practical and Research	PG
2.	UG Laboratory	40	UG Practical	UG
3.	Food Testing Laboratory		PG Research, Departmental Research and Commercial Sample Analysis	PG Research and Samples
	A. Biotech Cell	10
	B. Genomic Cell	5
	C. Bioinformatics Cell	5
	D. Proteomic Cell	10
	E. Microbial Cell	10
	F. MS/MS Cell	5
	G. GFQA Cell	10
	H. Separation Cell	10
	I. Elemental Cell	10

Click here to see the List of Major Equipment / Instruments

Click here to see the Images of Lab activities

M.Sc/Ph.D. Students Guided

Name of Guide	No. of students being supervised (guided) by faculty
Name of Guide	M.Sc. (Agri.)	Ph.D.
PLANT MOLECULAR BIOLOGY & BIOTECHNOLOGY
Dr. B. A. Golakiya	-	08
Dr. K. H. Dabhi	04	-
Dr. D. N. Vakhariya	-	02
Dr. T. Radhakrishnan	-	02
Dr. S. V. Patel	04	-
Dr. M. K. Mandavia	04	03
Dr. H. P. Gajera	04	10
Dr. R. S. Tomar	10	04
Dr. D. R. Mehta	04	03
Dr. R. B. Madariya	02	-
Dr. U. K. Kandoliya	08	-
Dr. G. V. Maraviya	06	-
Dr. M. K. Mahatma	02	-
Dr. Ashishkumar Vala	02	-
Dr Shraddha Bhatt	02	-
Dr. M. V. Parakhia	01	-
Biochemistry
Dr. D. N. Vakhariya	-	01
Dr. S. V. Patel	04	-
Dr. M. K. Mandavia	02	05
Dr. H. P. Gajera	07	03
Dr. U. K. Kandoliya	07	01
Dr. G. V. Maraviya	03	-
Dr. P. J. Rathod	05	-
Dr. M. K. Mahatma	-	-
Dr. Sarang S. Sapre	01	-

M.Sc. Theses Submitted

Sr. No.	Title of the thesis	Name of the student	Name of guide
Plant Molecular Biology and Biotechnology
Year 2015-16
1.	Molecular perspectives of Trichoderma strains and their antifungal activities during in vitro antagonism with Sclerotium rolfsii (Groundnut)	Hirpara Darshna G. (J4-01039-2012)	Dr. H. P. Gajera
2.	Molecular characterization of ridge gourd (Luffa acutangula L.) and sponge gourd (Luffa cylindrica L.)genotypes through PCR based molecular markers	Rathod Ravikumar R. (J4-01073-2012)	Dr. D. R. Mehta
3.	Molecular and Biochemical evaluation for drought tolerance in bread wheat (Triticum aestivum L.)	Gajera Hitesh P. (J4-01036-2012)	Dr. S. V.Patel
4.	Characterization of pyriculariya leaf spot resistant and susceptible pearl millet genotypes using biochemical and molecular markers	Vaja Vidushibahen N. (J4-01088-2012)	Dr. H. P. Gajera
5.	Molecular and biochemical characterization of leaf rust resistant and susceptible wheat (Triticum aestivum L.) genotypes	Bhimani Rahul D. (J4-01023-2012)	Dr. K. H. Dabhi
6.	Characterization of phytophthora blight resistant and susceptible sesame (Sesamum indicum L.) genotypes using molecular markers	Karad Kirtikumar D. (J4-01048-2012)	Dr. S. V. Patel
7.	Characterization of drought resistance and susceptible pearl millet (Pennisetumglaucum (L.) genotypes using biochemical and molecular markers.	Parmar Suhani B. (J4-01063-2012)	Dr. M. K. Mandavia
Year 2016-17
8.	Genetic diversity analysis of Ber (Ziziphus mauritiana l.) varieties through PCR based molecular markers	Dobariya Ashok B. (J4-01140-2013)	Dr. G. V. Marviya
9.	Diversity analysis of fenugreek (Trigonella foenum graceum L.) through molecular and biochemical markers	Korat Avni N. (J4-01162-2013)	Dr. U. K. Kandoliya
10.	Genetic diversity analysis among coconut (Cocos nucifera L.) Genotypes and hybrids by biochemical and molecular marker	Joshi Ankitaben K. (J4-01153-2013)	Dr. U. K. Kandoliya
11.	Molecular and biochemical characterization of chrysanthemum (Dendranthema grandiflora Tzevlev)	Awinash Gowda H. (J4-01335-2014)	Dr. K. H. Dabhi
Year 2017-18
12.	Molecular and phytochemical characterization of algal species from coastal belt of Okha region	Chudasama Amar A. (J4-01355-2014)	Dr. U. K. Kandoliya
13.	Molecular characterization for drought tolerance in cotton	Bhadani Rushitaben V. (J4-01342-2014)	Dr. S. V. Patel
14.	Molecular characterization of tomato (Solanum esculentum) genotypes for leaf curl viruses (ToLev)	Jayashree M. J. (2010115037)	Dr. U. K. Kandoliya
15.	Expression analysis of polyamines and ethylene biosynthesis genes in groundnut (Arachis hypogaea L.) during stem rot disease	Rakesh Nogiya (J4-01404-2014)	Dr. M. K. Mahatma
16.	Genome sequencing of Dill (Anethum graveolens L.) for development and validation of simple sequence repeat markers	Shiwani (2010115084)	Dr. M. K. Mandavia
17.	Molecular characterization of groundnut varieties differing in tolerance to aflatoxin production	Rahul Rammani Tripathi (J4-01400-2014)	Dr. H. P. Gajera
18.	Molecular screening and characterization of castor genotypes for root rot disease	Kachhadiya Harshita J. (J4-01371-2014)	Dr. R. B. Madariya
19.	Identification and validation of microsatellite markers through assembly of a partial genome for fennel (Foeniculum vulgare M.)	Pala Abhay B. (J4-01390-2014)	Dr. R. S. Tomar
20.	Molecular characterization of pearl millet (Pennisetum glaucum (L.) R. Br.) genotypes for salinity tolerance	Ravindrakumar Vijaykumar Baria (J4-01410- 2014)	Dr. G. V. Maraviya
21.	Evaluation of biochemical and molecular markers associated with salt tolerance in wheat genotypes	Pansuria Kruti C. (J4-01392-2014)	Dr. S. V. Patel
22.	De nova sequencing of ancient seed spice celery (Apium graveolens L.) and development of microsatellites	Shefalee Kishorbhai Parmar (J4-01416-2014)	Dr. M. K. Mandavia
23.	Molecular screening and characterization of castor genotypes for fusarium wilt resistance	Makwana Monika S. (2010115049)	Dr. R. B. Madariya
24.	Morphological, biochemical and moleculer characterization of brinjal (Solanum melongena L.)genotypes through PCR based molecular markers	Rucha Rajendrakumar Patel (J4-001184-2013)	Dr. D. R. Mehta
25.	Diversity analysis and sex determination in spine gourd (Momordica dioica Roxb.) using biochemical and molecular markers	Hirani Nimishaben V. (2010115028)	Dr. D. R. Mehta
26.	Development of genome wide simple sequence repeat markers using genome sequence of ajwain (Trachyspermum ammi L.)	Jogarana Mayur R. (J4-01370-2014)	Dr. R. S. Tomar
Year 2018-19
27.	Differential gene expression of GNAC TFs for drought stress in groundnut	Thoppurathu Feba Jacob (2010116121)	Dr. A. G. Vala
28.	Transcriptome profiling associated temperature and their gene expression in chickpea	Pandya Pryankaben M. (2010116085)	Dr. M. K. Mahatma
29.	Molecular characterization of garlic (Allium sativum L.) genotypes differ in total soluble content	Umaretiya Vidishaben R. (2010115088)	Dr. G. V. Maraviya
30.	Efficacy of thiourea application on biochemical changes in chickpea (Cicer arientium L.) under water deficit stress	Makadiya Mahek B. (2010115048)	Dr. M. K. Mandavia
31.	Molecular characterization of blackgram(Vigna mungo (L.) Hepper) genotypes for saline water tolerance.	Mukul Kumar Gandhi (2010116080)	Dr. G. V. Maraviya
32.	Molecular and biochemical characterization of wheat genotypes under heat stress condition	Kapadiya Kishan B. (2010116064)	Dr. K. H. Dabhi
33.	Differential gene expression of aquaporin for salinity stress in groundnut	Joshi Meeraben K. (2010116055)	Dr. G. V. Maraviya
34.	Molecular and isoenzymic characterization of indian bean (Lablab purpureus L.) genotypes	Dholakia Hemang P. (2010116034)	Dr. D. R. Mehta
35.	Phylogenetic relationship and molecular diversity analysis of promising genotypes and cultivers of mustard (Brassica juncea L.)	Moghariya Nikulkumar K. (2010115052)	Dr. H. P. Gajera
Year 2019-20
36.	Isolation and characterization of entomopathogenic microbes from the soils	Hirapara Kinjalkumari M. (2010117047)	Dr. S.B. Bhatt
37.	"Genome and transcriptome sequencing of barnyard millet (Echinochloa esculenta L.) for the development of geneic SSR marker and diversity analysis"	Meniya Vipul H. (2010117076)	Dr. R. S. Tomar
38.	"Genome and transcriptome sequencing of kodomillet (Paspalum scrobiculatum L.) for the development of geneic marker and diversity analysis"	Humble Nehali B. (2010117050)	Dr. R. S. Tomar
39.	Isolation, characterization and identification of halophilic bacteria from the soils of coastal regions of saurashtra	Likhindra Reang (2010117069)	Dr. S.B. Bhatt
40.	Genome and transcriptome sequencing of little millet (Panicum sumatense Roth.) for the development of genic SSR markers and its validation	Bhut Nishant H. (2010117019)	Dr. K.H.Dabhi
41.	Biochemical and molecular characterization for aroma in rice (Oryza sativa L.) genotypes of Gujarat region	Patil Rahul Ishwar. (2010117102)	Dr. A.G.Vala
Year 2020-21
42.	Molecular characterization and proximate composition of Maize (Zea mays L.)	Savaliya Nidhiben V. (2010118088)	Dr. G.V. Marviya
43.	Genetic characterization and diversity of nitrogen fixing Rhizobium Spp. isolated from root nodules of legumes	Muchhadiya Pooja M. (2010118065)	Dr. S. B. Bhatt
44.	Molecular diversity in onion(Allium cepa L.) genotypes	Sojitra Nidhee P. (2010118093)	Dr. R. B. Madariya
45.	Transcriptome profiling of in vitro regenerated Stevia rebaudiana genotypes and identification of candidate genes encoding steviol glycosides	Gadhiya Jaykumar A.(2010118026)	Dr. A. G. Vala
46.	Identification and characterization of candidate genes for drought and salinity tolerance in pearl millet [pennisetum glaucum l.]	Supreeth H.P. (2010118097)	Dr. R. S.Tomar
Year 2021-22
47.	Assessing genetic diversity of kodo millet (Paspalum scrobiculatum L.)genotypes using molecular markers	Thakkar Tirth K. (2010119102)	Dr. S. B. Bhatt
48.	Molecular marker based genetic diversity analysis in barnyard millet (Echinochloa frumentacea L.)	Jethava Kinjal M. (2010119044)	Dr. S. B. Bhatt
49.	Molecular diversity in Mustard (Brassica juncea L.)genotypes	Thummar Shweta D. (2010119104)	Dr. R. B. Madariya
50.	Development and utilization of molecular markers to study genetic diversity in sugarcane(Saccharum officinarum L.)	Jayasuriya U.S. (2010119042)	Dr. R. S. Tomar
51.	Development and validation of molecular marker for fresh seed dormancy in groundnut (arachis hypogaea l.)	Rathava Rajeshvari I. (2010119087)	Dr. S. Chandramohan
52.	Molecular and biochemical variability in promising genotypes of black sesame (Sesamum indicum l.)	Moliya Romik M. (2010119070)	Dr. U.K.Kandoliya
53.	Nutritional, anti-nutritional and molecular characterization of selected genotype of kabuli chickpea (Cicer arietinum L.)	Tajender kumar (2010119099)	Dr. U.K.Kandoliya Dr. H.P.Gajera
Year 2022-23
54.	Metagenomic profiling of soil microbial communities associated with halophytes	Kratika Nigam (2010120049)	Dr. R. S.Tomar
55.	Development and validation of SSR markers linked to stemrot disease resistance in groundnut	Gadge Vaishnavi Rajendra (2010120025)	Dr. Sangh Chandramohan
56.	Molecular characterization, nutritional and antinutritional parameters of promising genotypes of black gram [vigna mungo (l.) hepper]	Patel Kalpanabahen K. (2010120068)	Dr. U.K.Kandoliya
57.	Molecular characterization , nutritional and antinutritional parameters of promising mung bean(Vigna radiata (L.) Wilczek) genotypes	Taviyad Krishnaben L. (2010120085)	Dr. U.K.Kandoliya
58.	RNA- SEQ for differentially expressed gene(s) regulating drought and salt stress response in barnyard millet(Echinochola frumentaces L.)	Vaghela Tejasvini Indrajit (2010120089)	Dr. A.G.Vala
59.	Genetic diversity analysis in groundnut (Arachis hypogaea l.) Based on molecular markers and biochemical parameters	Jivani Jankiben M. (2010120038)	Dr. G.V.Maravia
Year 2023-24
60.	Molecular markers based genetic diversity analysis in finger millet [eleusine coracana (l.) gaertn.]	Dudhatra Rutu Jayesh bhai (2010121018)	Dr. S.B.Bhatt
61.	Assessment of molecular diversity and proximate composition in millets	Chovatiya Neha Dineshbhai (2010121013)	Dr. M.V.Parakhia
62.	Molecular and biochemical characterization of promising okra (abelmoschus esculentus) genotypes	Aashima Khajuria (2010121070)	Dr. U.K.Kandoliya
Biochemistry
Year 2015-16
1.	Biochemical changes in pearl millet (Pennisetum glaucum L.) seedling in response to chloride based salinity	Pansuriya Kalpesh R. (J4-01173-2013)	Dr. S. V. Patel
2.	Biochemical changes in pearl millet (Pennisetum glaucum L.) seedling in response to sulphate based salinity	Ukani Piyush K. (J4-01198-2013)	Dr. H. P. Gajera
3.	Evaluation of phenolics and antioxidant enzyme systems for fusarium wilt resistance in chickpea (Cicer arietinum L.) and their relationship with STMS markers	Chirag Vallabhbhai Patel (J4-01025-2012)	Dr. H. P. Gajera
4.	Evaluation of phenolics and antioxidant enzyme systems for phytophthora blight resistance in sesamum (Sesamum indicum L.)	Mori Disha S. (J4-01057-2012)	Dr. S. V. Patel
5.	Antioxidant and phytochemical characterization of custard apple (Annona squamosa L.)	Yashwant Kumar (J4-01093-2012)	Dr. H. P. Gajera
Year 2016-17
6.	Effect of PGPR on biochemical changes during different stages of coriander (Coriandrum sativum L.) seedlings	Warwate Sunil I. (J4-01435-2014)	Dr. U. K. Kandoliya
Year 2017-18
7.	Biochemical changes in groundnut (Arachis hypogaea L.) In response to stem rot (Sclerotium rolfsii) infection	Pipaliya Hardik R. (2010115062)	Dr. G. V. Maraviya
8.	Biochemical characterization for induced systemic resistance by Psedomonas antagonists against Alternaria Blight in cumin	Italiya Chirag J. (2010115034)	Dr. S. V. Patel
9.	Biochemical characterization for induced systemic resistance by Bacillus antagonists against Fusarium wilt in cumin	Kalaria Hiren S. (2010115040)	Dr. H. P. Gajera
Year 2018-19
10.	Biochemical changes influenced by nanoparticles treatments in germinating coriander (Coriandrum sativum L.)	Desai Niralben R. (2010116029)	Dr. S. V. Patel
11.	Effect of exogenous application of salicylic acid on green gram (Vigna radiate (L.) wilczek) irrigated with saline water	Trivedi Sandhyaben K. (2010116123)	Dr. U. K. Kandoliya
12.	Effect of exogenous application of salicylic acid on black gram (Vigna mungo (L.) Hepper) irrigated with saline water	Solanki Mitalben V. (2010115086)	Dr. U. K. Kandoliya
13.	Metabolomics and morphological characterization of macroalgae	Parmar Krupalkumar A. (2010116087)	Dr. P. J. Rathod
Year 2019-20
14.	Response of biochemical changes of thiourea application in wheat (Triticum aestivum L.) under water deficit stress	Guna Gautam D. (2010116043)	Dr. M. K. Mandavia
15.	Effect of salicylic acid on biochemical and physiological changes in pigeon pea (Cajanus cajan L.) in response to saline water stress	Bhuva Jaykumar V. (2010117020)	Dr. G. V. Maraviya
16.	Effect of seed priming of pearl millet (Pennisetum glacum L.) with salicylic acid on physiological and biochemical changes under salinity stress	Parmar Shraddhaben R. (2010117087)	Dr. M. K. Mandavia
17.	Effect of gibbrellic acid, Potassium nitrate and silicic acid on biochemical changes in cowpea (Vigna unguiculata L.Walp) seedling irrigated with saline water	Patel Riddhi S. (2010117099)	Dr. U. K. Kandoliya
18.	Effect of salicylic acid on biochemical and physiological changes in pigeon pea (Cajanus cajan L.) in response to water stress	Rakholiya Kishankumar P. (2010117110)	Dr. G. V. Maraviya
19.	Effect of gibbrellic acid, Potassium nitrate and silicic acid on biochemical changes in Groundnut (Arachis hypogaea L.) seedling irrigated with saline water	Purohit Harsh B. (2010117106)	Dr. U. K. Kandoliya
20.	Physiological and biochemical characterization of prickly pear accessions	Kadam Dipak D. (2010117055)	Dr. S.S. Sapre
21.	Biochemical changes influenced by nanoparticles tratments in germinating chilli (Capsicum annuum L.)	Parmar Bhavnaben R. (2010117085)	Dr. H.P.Gajera
Year 2020-21
22.	Biochemical changes influenced by nanoparticles treatments in germinating cumin (Cuminum cyminum L.)	Thummar Khushbu A. (2010118102)	Dr. H. P. Gajera
23.	Effect of growth regulators on physiological and biochemical changes in mothbean (Vigna aconitifolia Jacq.) irrigated with saline water	Shaikh Kaniz A.Fatema Samsuddeenbhai (2010118089)	Dr. U. K. Kandoliya
24.	Effect of salicylic acid on biochemical and physiological changes in maize (Zea mays L.) in response to water stress	Talavia Shrutiben Mahendrakumar (2010118099)	Dr. G. V. Marviya
25.	Biochemical aspect of processing in different millets	Patoliya Hinal Pravinbhai (2010118082)	Dr. S. S. Sapre
26.	Effect of growth regulators on physiological and biochemical changes in chickpea (Cicer arietinum L.) irrigated with saline water	Varun Y D (2010118111)	Dr.U. K. Kandoliya
Year 2021-22
27.	Biochemical changes in resistant and Susceptible Genotypes of Castor (Ricinus communis L.) in Response to Wilt (Fusarium oxysporum f.sp.ricini )Disease	Marakana Ravikumar Devjibhai (2010118059)	Dr. G. V. Marviya Dr. A. G. Vala
28.	Effect of edible coating on biochemical changes in guava fruit (Psidium guajava l.) during storage	Makadiya Dhruvinkumar D. (2010119059)	Dr. S. S. Sapre
29.	Biochemical and minerals profiling of peanut (Arachis hypogaea L.) genotypes	Varu Harsh Punjabhai (2010119117)	Dr. P. J. Rathod
30.	Decoding of phytochemicals and bioactive compounds of some medicinal plants growth in saurashtra region	Umamaheshwar Y (2010119107)	Dr. P. J. Rathod
31.	Assessment of diversity in brinjal (Solanum melongena L.) fruit colour through biochemical and metabolic traits	Ram Mayurkumar L. (2010118084)	Dr. P. J. Rathod
32.	Influence of salinity stress and seed priming on biochemical aspects of wheat (Triticum aestivum L.)seedling	Patel Shreya S. (2010119084)	Dr. G.V.Marviya
33.	Biochemical changes influenced by nanoparticle treatments during fusarium wilt infection in castor (ricinus communis L.)	Chovatiya Nirbhay C. (2010119020)	Dr. H.P.Gajera
34.	Biochemical changes in pearl millet flour during storage.	Ninama Sandhyadevi S. (2010119076)	Dr. S. S. Sapre
35.	Effect of roasting and storage on nutritional quality of groundnut (Arachis hypogaea L.)kernels.	Mahla Nitignakumari S. (2010119057)	Dr. M.K.Mahatma
Year 2022-23
36.	Protein and fatty acid profiling of spreading, semi spreading and bunch types varieties of groundnut (arachis hypogaea l.)	Gore Vishnu Baparao (2010120033)	Dr. P.J.Rathod
37.	Effect of different polysaccharide based edible coatings on shelf life of tomato (Lycopersicon esculentum L.)	Sondarva Rutvik Pravinbhai (2010120083)	Dr. S. S. Sapre
38.	Effect of seed priming on biochemical parameters under water stress in chickpea (cicer arietinum l.)	Pansara Parthkumar Naranbhai (2010120064)	Dr. G.V.Marviya
39.	Effect of nanoparticles on physiological and biochemical parameters under water stress in wheat (triticum aestivum L.)	Gulla Bhavitha (2010120034)	Dr. G.V.Marviya
Year 2023-24
40.	Effect of different agricultural waste on growth, yield and nutritional composition of oyster mushroom (pleurotus ostreatus)	Akola Riddhi Kantibhai (2010121001)	Dr. S.S. Sapre
41.	Effect of growth regulators on physiological and biochemical changes in pearl millet [Pennisetum glaucum (l.) r. br.] irrigated with saline water	Kundan (2010121076)	Dr. G.V.Maravia

Ph.D. Theses Submitted

Sr. No.	Title of the thesis	Name of the student	Name of guide
Plant Molecular Biology and Biotechnology
Year 2015-16
1.	De novo transcriptome sequencing to discover putative genes associated with drought tolerance and their expression in pearl millet (Pennisetum glaucum l.)	Anatala Tusharkumar J. ( J4-01016-2012	Dr. M. K. Mandavia
2.	Molecular and biochemical characterization of drought tolerant endophytic bacteria isolated from wildpoaceae family plants	Akbari Disheeta L. (J4-00794-2011)	Dr. B. A. Golakiya
3.	Molecular and biochemical characterization of salt tolerant endophytic bacteria isolated from wild malvaceae family plants	Bhadania Roshani A. (J4-01021-2012)	Dr. B. A. Golakiya
4.	Gene expression study of host pathogen interaction during papaya ring spot virus infection in papaya (Carica papaya L.)	Pritesh Hargovindbhai Sabara (J4-00523-2009)	Dr. D. N. Vakharia
5.	Whole genome sequencing of sesame (Sesamum indicum L.) cv. guj. til-10 using next-generation sequencer"	Vaja Mahesh B. (J4-00686-2010)	Dr. B. A. Golakiya
Year 2016-17
6.	Interspecific protoplast fusion between Trichoderma harzianum and Trichoderma viride for biocontrol improvement	Lakhani Hardik N. (J4-00641-2010)	Dr. D. N. Vakharia
7.	Molecular characterization of Psedomonas for biocontrol activity in phytopathogen systems	Vaja Komalben N. (J4-01200-2013)	Dr. H. P. Gajera
Year 2017-18
8.	Molecular characterization of aflatoxin producing aspergillus in groundnut and their remedies with bacterial nanoparticles	Bharose Achyut A. (J4-01345-2014)	Dr. H. P. Gajera
9.	Transcriptome Profiling of chickpea (Cicer arietinum L.) with relation to wilt disease (Fusarium oxysporum f. sp. Ciceri)	Jasminkumar Vanmalibhai Kheni (J4-01151-2013)	Dr. B. A. Golakiya
10.	Characterization of transgenic groundnut (Arachis hypogaea L.) expressing the ZAT12 transcription factor gene under abiotic stresses	Abhay Kumar (J4-01014-2012	Dr. T. Radhakrishnan
11.	Transcriptome dynamics and biochemical appraisal of Arachis hypogaea ssp. virginia bunch during flower development	Umretiya Nimita G. (J4-01423-2014)	Dr. B. A. Golakiya
12.	Isolation, antagonism and genome characterization of aflatoxigenic and atoxigenic Aspergillus	Jayeshkumar Harjibhai Kahodariya (J4-00627-2010)	Dr. H. P. Gajera
13.	Transcriptome analysis of wheat (Triticum aestivum L. Em. Thell) under heat stress at booting stage	Nandha Abhijeeta K. (J4-01389-2014)	Dr. D. R. Mehta
14.	Genome and transcriptome sequencing of coriander (Coriandrum sativum L.) to reveal its genome architecture	Tulsani Nilam J. (J4-01422-2014)	Dr. B. A. Golakiya
15.	Linkage and QTL mapping for blast resistance in pearl millet (Pennisetum glaucum (L.) R. Br.	Sanghani Jayeshkumar M. (J4-01187-2013)	Dr. B. A. Golakiya
Year 2018-19
16.	Insilico identification and target prediction of microRNAs and their expression profiling in Sesamum indicum L.	Joshi Halakben Vibhakarbhai Minaxiben (J4-01154-2013)	Dr. M. K. Mandavia
17.	micro RNA profiling, antifungal and nanoformulation characterization of multi stress tolerant Trichoderma fusants for biocontrol activity against Sclerotium rolfsii sacc. causing stem rot in Groundnut	Hirpara Darshna G. (1010115007)	Dr. H. P. Gajera
18.	Construction of linkage mapping and identification of quantitative trait loci (QTL) for earliness, grain size and leaf rust resistance in bread wheat (Triticum aestivum L.)	Delvadiya Niravkumar A. (J4-01137-2013)	Dr. D. R. Mehta
19.	De novo transcriptome sequencing and metabolom analysis at flowering stage in off season bearing Mango (Mangifera indica L.)	Desai Hiralben V. (J4-01357-2014)	Dr. M. K. Mandavia
20.	Molecular analysis of transgenic groundnut (Arachis hypogaea L.) expressing the transcription factor DREB1A driven by an inducible promoter under drought stress	Bhalani Hiren N. (J4-01022-2012)	Dr. Radhakrishnan T.
Year 2019-20
21.	Mapping and validation of SSR markers associated with foliar-fungal disease resistance QTLs and development of RILs in groundnut(Arachis hypogaea L.)	Suhail Ahmed A. Hakeem. (J4-01418-2014).	Dr. H. P. Gajera
22.	Transcriptome and hormone profiling of sesame (Sesamum indicum L.) during interaction with macrophomina phaseolina.	Radadiya Nidhi G. (101015013)	Dr.B.A. Golakiya
Year 2020-21
23.	Molecular approach for development of potential beauveria based nano -biopesticide to control infection of sucking pest.	Bhadani Rushita V. (1010117002)	Dr. H. P. Gajera
24.	Transcriptome &Metabolic profiling in response to fusarium wilt in castor (Ricinus communis L.)	Kachhadiya Harshita J. (1010117009)	Dr. D. R.Mehta
25.	Comparative transcriptome and metabolomics profiling of aflatoxin resistant and susceptible groundnut influenced by toxigenic and non-toxigenic Aspergillus flavus	Antala Virali G. 1010116001	Dr. B. A. Golakiya
26.	Transcriptome sequencing and metabolomic characterization of barnyard millet (Echinochloa frumentacea L.) to discover putative genes involved in spike development and its neutraceutical properties flavus	Padhiyar Shitalben M. (1010117014)	Dr. R. S. Tomar
27.	Utilizing groundnut (Arachis hypogaea L.) rhizosphere microbiome for biological control of dry root rot	Parakhiya Manojkumar V. (J4-01443-2014)	Dr. B. A. Golakiya
28.	Transcriptome and metabolic profiling in response to root rot (Macrophomina phaseolina)infection in mungbean [Vigna rediata (L.)Wilczek]	Dabhi Kirtibahen A. (1010116004)	Dr. H. P. Gajera
Year 2021-22
29.	Comparative Transcriptome analysis of male and female flower in spine gourd (Momordica dioica)during different stages of bud formation	Vasava Divyesh K. (1010118025)	Dr. R. S. Tomar
30.	CRISPR-mediated genome editing in tomato (Solanum lycopersicum Mill) for herbicide resistance	Shashikant Sharma (1010117025)	Dr. B. A. Golakiya
31.	De novoTranscriptome analysis of a medicinal plant:Telosma pallida L.	Umaretiya Vidisha R. (1010118023)	Dr. D. R. Mehta
32.	Transcriptome and phytohormone profiling of groundnut (Arachis hypogaea L.) to understand the mechanism of fresh seed dormancy	Hemangini A. Chaudhary (1010117006)	Dr. M.K.Mahatma
Year 2022-23
33.	Genome editing through crispr-cas 9 for improvement of oil quality in soybean(Glycine max (L.) merrill	Rathod Balaji Ulhas (1010119025)	Dr. R. S.Tomar
34.	Microbiome diversity and metagenomics analysis associated with Fusarium Wilt in cumin rhizosphere	Hirani Nimisha Vinubhai (1010118011)	Dr. H.P.Gajera
35.	Gene expression of castor genotype upon fungal infection (macrophomina phaseolina) and identification of disease resistant gene	Shulabhi Verma (J4-00532-2009)	Dr. B.A.Golakiya
36.	De Novo transcriptome sequencing and metabolomics profiling to discover putative genes of Little Millet(panicum sumatrense L.) associated to drough tolerance	Dhawale Ramesh NarayanRao (1010119006)	Dr. R.S.Tomar
37.	Transcriptome and biochemical changes influenced by nanosilicon under drought in germinating chickpea (cicer arietinum l.)	Hirapara Kinjalkumari Mukeshbhai (1010119009)	Dr. H.P.Gajera
Year 2023-24
38.	Transcriptome and biochemical depictions of developing anther influenced by salicylic acid functionalized nanochitosan under heat stress in cotton (gossypium hirsutum l.)	Savani Khyati Rasikbhai (1010120023)	Dr. H.P.Gajera
Biochemistry
Year 2017-18
1.	Biochemical and molecular basis of innate and Pseudomonas flurescence induced stem rot tolerance in groundnut (Arachis hypogeae L.)	Sujit Kumar Bishi (J4-01084-2012)	Dr. D. N. Vakharia
2.	Transcriptomic and metabolomic analysis of groundnut (Arachis hypogaea L.) under varying temperature	Raval Sacheenkumar S. (J4-01183-2013)	Dr. M. K. Mahatma
3.	Biochemical and molecular changes in Pearl Millet (Pennisetum glaucum L.) genotypes subjected to short term water stress and its revival	Deshmukh Shubham Babanrao ( J4-01028-2012)	Dr. M. K. Mandavia
Year 2018-19
4.	Isolation, separation, identification and characterization of an active ingredients from anticancer medicinal plants	Joshi Kavita B. (J4-01155-2013)	Dr. M. K. Mandavia
5.	Isolation, separation and identification of active ingredients from antidiabetic medicinal plants	Timbadiya Priyanka N. (J4-01421-2014)	Dr. M. K. Mandavia
Year 2019-20
6.	Biochemical and molecular analysis in pearl millet (Pennisetum glaucum L.) genotypes under heat stress during flowering stage	Ukani Piyush K. (1010116019)	Dr. M. K. Mandavia
Year 2020-21
7.	Biochemical and molecular characterization of chickpea (Cicer arietinum L.)under heat stress	Pipaliya Hardik R. (1010117017)	Dr. H.P.Gajera
Year 2021-22
8.	Biochemical changes influenced by silicon and nano-silicon during salt stress in chickpea (Cicer arietinum L.)	Trivedi Sandhya K. (1010118022)	Dr. H. P.Gajera
9.	Biochemical and molecular evalution of nutritional and anti -nutritional compounds in groundnut kernals at various pod developing stages during moisture deficit condition.	Solanki Mitalben V. (1010118021)	Dr. M.K.Mahatma
Year 2022-23
10.	Biochemical changes influenced by nano-silicon under salinity in germinating seeds of Groundnut (Arachis hypogaea L.)	Purohit Harsh Bharatbhai (1010119024)	Dr. H.P.Gajera
Year 2023-24
11.	Deciphering the efficacy of iron oxide nanoparticles to mitigate nutritional requirement in groundnut	Smrutirekha Sahu (1010120024)	Dr. U.K.Kandoliya

Faculty Participated in Trainings/Refresher Course/Summer/Winter School etc.

Sr. No.	Name of Faculty	Period			Nature of Training	Place
Sr. No.	Name of Faculty	From		To
Year 2015-16
1.	Dr. V. B. Rathod	20/07/2015		16/08/2015	Orientation programme	UGC: HRDC, Saurashtra university, Rajkot, Gujarat (India).
2.	Dr. P. J. Rathod	20/07/2015		16/08/2015	Orientation programme	UGC: HRDC, Saurashtra university, Rajkot, Gujarat (India).
3.	Dr. U. K. Kandoliya	20/07/2015		16/08/2015	Orientation programme	UGC: HRDC, Saurashtra university, Rajkot, Gujarat (India).
4.	Dr. R.S. Tomar	06/05/2015		26/05/2015	Winter school on RNA-interference as a tool for Plant functional genomics and crop improvement	ICAR-NRCPB, New Delhi.
5.	Dr. M. V. Parakhia	06/05/2015		26/05/2015	Winter school on RNA-interference as a tool for Plant functional genomics and crop improvement	ICAR-NRCPB, New Delhi.
6.	Dr. A. G. Vala	18/05/2015		02/06/2015	Summer training on plant tissue culture	Plant tissue culture laboratory, Anand Agricultural University, Anand.
Year 2016-17
1.	Dr. S. B. Bhatt	02/02/2016		07/02/2016	Food and Feed safety of GM crops	National institute of Nutrition, Hyderabad
2.	Dr. S. B. Bhatt	22/12/2016		23/12/2016	Leadership and Entrepreneruship Development	JAU, Junagadh.
3.	Mr . V. G. Vyas	16/04/2016		19/04/2016	lab management & Internal Audit (NABL	STQC directorate CETE –Pune
Year 2017-18
4.	Dr. H. P. Gajera		16/01/2018	25/01/2018	Techniques for estimation of nutraceutical properties from crops	Dept of Biochemistry, AAU, Anand during 16-25 January, 2018.
5.	Dr. U. K. Kandoliya, Dr. G. V. Marviya Dr. P. J Rathod, Prof. V. B., Rathod Dr. S. B. Bhatt		04/09/2017	24/09/2017	Genomic, Proteomic and Metabolomic Application in crop Improvement	Department of Biotechnology, JAU, Junagadh
Year 2018-19
1.	Dr. A. G. Vala	24/09/2018		26/09/2018	3-day workshop on transgenic trait detection in crops	Dept of Biotechnology, JAU, Junagadh
2.	Dr. A. G. Vala	1/09/2018		21/09/2018	21-day training on Comparative genomics of horticultural plants genetic resources	UAS, Bangalore
3.	Dr. A. G. Vala	22/10/2018		23/10/2018	2-day workshop on recent advance in tools for genetic studies	Dept of Biotechnology, JAU, Junagadh
Year 2019-20
1.	Dr. Rukam S. Tomar	14/10/2019		25/10/2019	International Hands-on Training on Genome Editing Technologies	Asia-Pacific Association of Agricultural Research Institutions (APAARI) at ICRISAT, Hyderabad
Year 2021-22
1.	Dr. H. P. Gajera Dr. M. V. Parakhia	09/08/2021		13/08/2021	"Pesticide Residues in Food and Environmental Samples"	jointly organized by Agilent University and Food Testing Laboratory, JAU, Junagadh
2.	Dr.P.J Rathod	12/07/2021		14/07/2021	Three days International Training prograamme on Biofortification: key to nutritional Security	MANAGE Hyderabad and Hravest plus,USA

Seminar / Symposia / Workshop Attended by Faculty

Sr. No.		Name of Faculty		Period		Place	Title
Sr. No.		Name of Faculty		From	to	Place	Title
Year 2015-16
1.	Dr. S. B. Bhatt			21/02/2016	28/02/2016	National institute of nutrition, Hyderabad, Telangana.	Food and Feed safety of GM crops
2.	Dr. A. G. Vala			29/06/2015	29/06/2015	Ahmedabad	Biotechnology for climate change in agriculture
3.	Dr. A. G. Vala			11/08/2015	11/08/2015	Dept. of Biotechnology, JAU, Junagadh	Microwave Plasma Atomic Emission Spectroscopy Workshop
Year 2016-17
1.	Dr. H. P. Gajera, Dr. G. V. Marviya, Dr. U. K. Kandoliya, Ms. V. B. Rathod			06/12/2016	08/12/2016	Department of Biochemistry, B.A.College of Agriculture, Anand Agricultural	Nutraceuticals and Functional Foods: The Challenges andOpportunities University, Anand-388110, INDIA
2.	Dr. G. V. Marviya, Dr. U. K. Kandoliya			26/09/2016	26/09/2016	Junagadh Agricultural University, Junagadh	Technological Changes and Innovation in Pomegranate Production and Utilization for Enhancing Farmers Income
3.	Dr. Rukam Singh Tomar			22/02/2016	23/02/2016	NASC Complex, New Delhi	Environmental Risk Assessment of Genetically Engineered Plants
4.	Dr. S. B. Bhatt			23/12/2016	23/12/2016	Gujarat Vidyapith	Pashupalan and Sajivkheti
Year 2017-18
			Dr. S. B. Bhatt	13/07/2017	13/07/2017	AAU, Anand	State level Biosafety Capacity Building
Year 2019-20
1.			Prof. M. V. Parakhia, Dr. H. P. Gajera, Dr. P. J. Rathod, Prof. V. B. Rathod, Dr. S. B. Bhatt	27/09/2019	27/09/2019	College of agriculture engineering and technology, JAU, Junagadh	Workshop on "Application of Nuclear energy in Agriculture and food"
2.			Dr. H. P. Gajera, Dr. A. G. Vala, Dr. U. K. Kandoliya, Prof. V. B. Rathod	14/10/2019	15/10/2019	Junagadh agricultural University, Junagadh	Sensitization Workshop on “NAHEP, Component-2A: Activities and Implementation of Acadamic Management System (AMS)”
3.			Dr. H. P. Gajera, Dr. A. G. Vala	12/12/2019	13/12/2019	Navsari Agricultural University, Navsari	Seminar on "Biochemical and Molecular Biology Intervention for Nutritional Security and Food Safety"
Year 2022-23
1.			Dr. M. V. Parakhia	27/06/2022	03/07/2022	Glostem and Indian Young Academy of Science	Genome editing : Basic to advance application in agriculture , Pharma and health sector
2.			Dr.P.J Rathod	16/02/2023	17/02/2023	NAHEP,IDP,ICAR worldbank Junagadh	Waste Urtilizaation and management for Energy generation
Year 2023-2024
1.			Dr.P.J Rathod	05/06/2023	06/06/2023	NAHEP,IDP,ICAR world bank Junagadh	Use of modern technologies & Automation in food processing
2.			Dr. H. P. Gajera Dr. M. V. Parakhia	05/10/2023	07/10/2023	Junagadh Agricultural University, Junagadh	Workshopon NARES - Blended learning platform under NAHEP by ICAR-IASRI
3.			Dr. H. P. Gajera Dr. M. V. Parakhia	06/06/2023	06/06/2023	Junagadh Agricultural University, Junagadh	GAAS Seminar "Modern Agricultural Practices of Coconut: Problems and Remidies"
4.			Dr. H. P. Gajera Dr. M. V. Parakhia	04/12/2023	05/12/2023	Junagadh Agricultural University, Junagadh	Workshopon The Growing Role of Artificial Intellingence in Agriculture: Revolutionizing Farming practices under NAHEP - IDP

Seminar/workshop/symposia organized by the Department

Sr. No.	Title	Period			Place	Organized by
		From	To
Year 2015-16
1	Microwave Plasma Atomic Emission Spectroscopy Workshop	11/08/2015	11/08/2015		Food Testing Laboratory (FTL) of Department of Biotechnology, Junagadh Agricultural University, Junagadh	Department of Biotechnology, JAU in collaboration withAgilent technologies
2	Campus to Corporate Training cum Seminar	17/10/2015	17/10/2015		Food Testing Laboratory (FTL) of Department of Biotechnology, Junagadh Agricultural University, Junagadh	Department of Biotechnology, JAU in collaboration withDirectorate of Student Welfare
3	Beachell-Borlaug International Scholars Program	17/12/2015	17/12/2015		Food Testing Laboratory (FTL) of Department of Biotechnology, Junagadh Agricultural University, Junagadh	Department of Biotechnology, JAU in collaboration withMonsanto’s
Year 2016-17
1.	An insight into NGS : the ultimate companion in cutting edge research	22/04/2016	22/04/2016		Food Testing Laboratory (FTL) of Department of Biotechnology, Junagadh Agricultural University, Junagadh	Department of Biotechnology, JAU sponsored with Bioinnovation
Year 2017-18
1	Bioinformatics Tools and Analysis (CLC and IPA Genomics)	12/05/2017		12/05/2017	Food Testing Laboratory (FTL) of Department of Biotechnology, Junagadh Agricultural University, Junagadh	Department of Biotechnology, JAU, Junagadh sponsored by Qiagen
2	Recent Trends and Techniques In Genomics and Proteomics for Agriculture	12/10/2017		12/10/2017	Department of Biotechnology, Junagadh Agricultural University, Junagadh	Department of Biotechnology, JAU, Junagadh sponsored by Merck Life science
Year 2018-19
1	Transgenic trait detection in crop	24/09/2018		26/09/2018	Department of Biotechnology, Junagadh Agricultural University, Junagadh	Department of Biotechnology, JAU, Junagadh sponsored by Gujarat State Biotechnology Mission, Gandhinagar
2	Recent advances in tools for genetic studies	22/10/2018		23/10/2018	Food Testing Laboratory (FTL) of Department of Biotechnology, Junagadh Agricultural University, Junagadh	Department of Biotechnology, JAU, Junagadh sponsored by ThermoFisher Scientific

Training organized by the Department

Sr. No.	Title	Period		Place	Nature of training	No. of Participants
Sr. No.	Title	From	To	Place	Nature of training	No. of Participants
Year 2015-16
1	Farmers day	09/09/2015	09/09/2015	Food Testing Laboratory (FTL) of Department of Biotechnology, Junagadh Agricultural University, Junagadh	One day training programme for farmers on Farmers Day	About 100
Year 2017-18
1	Winter School on Genomic, Proteomic and Metabolomic Application in Crop Improvement	04/09/2017	24/09/2017	Department of Biotechnology, Junagadh Agricultural University, Junagadh	Department of Biotechnology, JAU, Junagadh	30
Year 2019-20
1	Automation and Advances in Chromatography	06/09/2019	07/09/2019	Dept. of Veterinary Pharmacology and Toxicology, College of Veterinary Science and A.H., JAU, Junagadh, and Food Testing Laboratory, JAU, Junagadh	Training on TLC, HPTLC, HPLC, LC-MS QTOF, Gas Chromatography, GC-MS QTOF and Preparative HPLC	85 U.G. Students of Veterinary
Year 2022-23
1	Next Generation Sequencing	21/11/2022	25/11/2022	Jointaly organized by Gujarat Biotechnology Research Centre, Gandhinagar and Department of Biotechnology, JAU, Junagadh at Junagadh	Hands on trainigng on Next generation sequencing	15
Year 2023-24
1.	Application of Next Generation DNA Sequencing Technology in Agriculture	26/06/2023	30/06/2023	Under the IDP-NAHEP by Dept. of Biotechnology, JAU, Junagadh	A Five days Skill development training	30 UG students

Papers Published in Journals

Sr. No.	Details of Publication	NAAS Rating
Year 2015-16
1.	Gajera, H. P.; Savaliya, D. D.; Patel, S. V. and Golakiya, B. A. (2015).Trichoderma viride induces pathogenesis related defense response against rot pathogen infection in groundnut (Arachis hypogaea L.). Infection,Genetics and Evoution, 34: 314–325.	9.26
2.	Gajera, H. P.; Bambharolia, R. P.; Hirpara, D. G.; Patel, S. V. and Golakiya, B. A. (2015). Molecular identification and characterization of novel Hypocrea koningii associated with azo dyes decolorization and biodegradation of textile dye effluents. Process Safety and Environmental Protection, 98: 406–416.	7.83
3.	Parmar, H. J.; Bodar, N. P.; Bhadja, N. V.; Patel, S. V.; Kandoliya, U. K. and Golakiya, B. A. (2015). In vitro antagonism between biocontrol agent Trichoderma and pathogen Sclerotium rolfsii causing stem rot in Arachis hypogaea L. Journal of Cell and Tissue Research, 15(1): 4921-4928.	4.2
4.	Saba, I.; Parvaze, A. S.; Kandoliya, U. K. and Baba, Z. A. (2015). Natural variation for seed physical, biochemical,and culinary traits in common bean (Phaseolus vulgaris L.). Current Botany, 6(1): 1-8.	-
5.	Akbari D. L.; Akbari, L. F.; Bhadania R. A.; Parkhiya, M. V. and Golakiya, B. A. (2015). Plant growth promoting traits and in vitro antagonism of drought tolerant endophytic bacteria isolated from grasses of kutch. Journal of Cell and Tissue Research, 15(3): 5241-5246.	4.38
6.	Marviya, G. V. and Vakharia, D. N. (2015). Yield and yield attributes as influenced by terminal water stress and benzyl adenine in pearl millet [Pennisetum glaucum (L.) R. Br.] genotypes published in the proceedings of national seminar on 'Water management and climate smart agriculture' held during 13^th-14^th February, 2015 at Junagadh Agricultural University, Junagadh edited by R. Subbaiah and G. V. Prajapati, 1: 182-94.	-
7.	Chavan, R. S.; Kumar, A.; Bhatt, S. and Nalawade, T. (2015). Whey based beverage: its functionality, formulations, health benefits and applications. Journal of Food Processing and Technology,6(10): 495.	6.67
8.	Kapadia, C. V.; Mahatma, M. K.; Parekh, M. J.; Patel, N. and Tomar, R. S. 2015. Identification of resistance gene analogs (RGAS) from highly wilt resistant castor (Ricinus Communis L.) genotype. Research Journal of Biotechnology, 10(5): 16-26.	6.26
9.	Das, T.; Mandavia, M. K. and Mandavia, C. K. (2015). Alterations in biochemical responses and antioxidant enzymes in wheat (Triticum aestivum L.) genotypes under NaCl Salinity Stress. Indian Journal of Agricultural Biochemistry, 28(1): 57- 60.	4.02
10.	Sanghani, J. M.; Mandavia, M. K.; Sanghani, A. O.; Raval, S. S. and Golakiya, B. A. (2015). Analysis of genetic diversity among mungbean (Vigna radiata L.) genotypes through different Biochemical markers. Indian Journal of Agrilcultural Biochemistry, 28(1): 24-28.	4.03
11.	Patel, S. V.; Mandavia, M. K. and Golakiya, B. A. (2015). Assessment of genetic diversity among groundnut(Arachis hypogaea L.) genotypes using molecular markers, Indian Journal of Agricultural Biochemistry, 28(1): 70-76.	4.03
12.	Raval, S. S.; Mandavia, M. K.; Sanghani, J. M.; Mahatma, M. K. and Golakiya, B. A. (2015). Separation and identification of phytochemicals from Rscoea procera wall. Indian Journal of Agricultural Biochemistry, 28(2): 143-149.	4.03
13.	Das, T.; Meena, M.; Mandavia, M. K. and Sapre, S. S. (2015). Influence of NACL salt stress on physiological, biochemical and isoenzyme pattern in Wheat genotypes. Research in Environent and Life Science, 8(4): 825-828.	4.25
14.	Thummar. V. D.; Tomar, R. S.; Parakhia, M. V.; Padhiyar, S. M. and Rathod, P. J. (2015). Detection of genetic variation in tissue culture clones of date palm using ISSR markers, International Journal of Scientific Research and Development, 3(10): 37-40.	-
15.	Dhingani, R. M.; Umrania, V. V.; Tomar, R. S.; Parakhia, M. V. and Golakiya, B. A. (2015). Introduction to QTL mapping in plants. An Plant Science, 4(04): 1072-1079.	-
16.	Kandoliya, U. K.and Vakharia, D. N. (2015). Ascorbic acid and ascorbate peroxidase based defense system induced by Pseudomonas fluorescens against wilt pathogen in chickpea. International Journal of Plant Protection, 8(1): 86-92.	3.3
17.	Kandoliya, U. K.; Bajaniya, V. K.; Bhadja, N. V.; Bodar, N. P. and Golakiya, B. A. (2015). Antioxidant and nutritional components of egg plant (solanum melongena L) fruit grown in Saurastra region. Intenational Journal of Current Microbiology and Applied Science, 4(2): 806-813. (ISSN: 2319-7706).	-
18.	Kandoliya U. K.; Bodar, N. P.; Bajaniya, V. K.; Bhadja N. V. and Golakiya B. A. (2015). Determination of nutritional value and antioxidant from bulbs of different onion (Allium cepa) variety: A comparative study. Intenational Journal of Current Microbiology and Applied Science, 4(1): 635-641. (ISSN: 2319-7706).	-
19.	Bajaniya, V. K.; Kandoliya, U. K.; Bodar, N. P.; Bhadja, N. V. and Golakiya, B. A. (2015). Phytochemical characterization of Butea monosperma seed oil. International Journal of Current Research Academic Review, 3(5): 282-287.(ISSN 2347 - 3215)	-
20.	Patel, N. J.; Kandoliya, U. K. and Talati, J. G. (2015). Induction of phenol and defense-related enzymes during wilt (Fusarium udum Butler) infestation in pigeon pea. Intenational Journal of Current Microbiology and Applied Science, 4(2): 291-299. (ISSN: 2319-7706).	-
21.	Bajaniya, V. K.; Kandoliya, U. K.; Bodar, N. H.; Bhadja, N. V. and Golakiya, B. A. (2015). Fatty acid profile and phytochemical characterization of bael seed (Aegle marmelos L.) oil. Intenational Journal of Current Microbiology and Applied Science, 4(2): 97-102. (ISSN: 2319-7706).	-
22.	Vyas, V. G.; Kandoliya, U. K.; Vidhani, S. I.; Parmar, H. J.; Bhalani, V. M. and Golakiya, B. A. (2015).Heavy metal deposition and Phytochemical characterization of curry leaves (Murraya koenigii).Intenational Journal of Current Microbiology and Applied Science, 4(10): 839-843.	-
23.	Kandoliya, U. K.; Marviya, G. V.; Patel N. J.; Vakharia D. N. and Golakiya, B. A. (2015). Effect of drought at different growth stage on carbohydrates and lipids composition of groundnut (Arachis hypogaea L.) pod. International Journal of Current Research Academic Review, 3(10): 281-287.	-
24.	Chavan, R S.; Kumar, A. and Bhatt, S. (2015). Tomato soup premix base: development and optimization using response surface methodology. International Journal of Engineering Research, 3(1): 35-48.	6.07
25.	Rathod, P. J.; Vakharia, D. N.; Patel, S. V. and Golakiya, B. A. (2015). Trends in antioxidant enzymes pattern of chickpea grown in healthy plot and sick plot contaminated with wilt disease. International Journal of Scientific Research and Development, 3(9): 222-26.	IF:2.49
26.	Vaja, M. B.; Rathod, P. J.; Mandavia, M. K. and Golakia, B. A.(2015). Genetic purity and diversity in isoenzyme Peroxidase of pearl millet hybrids. Asian Journal of Biological Science, 10(21): 153-157.	3.75
27.	Gevariya, S. N.; Gajera, H. P.; Savaliya, D. D. and Golakiya, B. A. (2015). Phytochemical screening and antioxidant activity of Syzygium cumini L. fruit extracts. Indian Journal of Agricultural. Biochemistry, 28(1): 65-69.	4.03
28.	Anatala, T. J.; Mandavia, M. K.; Dave, R. A.; Kothari, V. V.; Gajera, H. P.; Ramani, H. R.; Patel, S. V. and Golakiya, B. A. (2015). Protein profile and isoenzymes in response to water stress in pearl millet. Journal of Cell and Tissue Research, 15(3): 5255-5266.	4.38
29.	Parmar, K.; Tomar, R. S.; Parakhia, M. V.; Malviya. B. J.; Rathod, V. M.; Bhatt, A. J.; Bhalara, R. B. and Golakiya, B. A. (2015). Molecular characterization of chloropyrifos degrading bacteria and gene, Journal of Cell and Tissue Research, 15(3): 5233-5239.	4.38
30.	Anatala, T. J.; Gajera, H. P.; Mandavia, M. K.; Dave, R. A.; Kothari, V. V. and Golakiya, B. A. (2015). Leaf proteome alterations in tolerant pearl millet. International Journal of Agriculture, Environmnt and Biotechnology, 8(3): 539-549.	4.10
31.	Gajera, H. P.; Savaliya, D. D.; Patel, S. V. and Golakiya, B. A. (2015). Lipoxygenase-related defense response induced by Trichoderma viride against Aspergillus niger Van Tieghem, inciting collar rot in groundnut(Arachis hypogaea L.). Phytoparasitica, 43: 229–240.	6.68
32.	Sodha, K. H.; Jadav, J. K.; Gajera, H. P. and Rathod, K. J. (2015). Characterization of silver nanoparticles synthesized by different chemical reduction methods. International Journal of Pharma and Bio Science, 6(4): 199 - 208.	-
33.	Rathod, R. R.; Mehta, D. R.; Gajera, H. P. and Delvadiya, N. A. (2015). Molecular characterization of ridge gourd (Luffa acutangulaL.) and sponge gourd (Luffa cylindrica L.) genotypes through PCR based molecular markers. International Journal of Agriculture, Environmnt and Biotechnology, 8(3): 521-530.	4.10
34.	Tomar, R. S.; Parakhia, M. V.; Rathod, V. M.; Kheni, J. V.; Thakkar, J. R.; Thummar, V. D.; Padhiyar, S. M. and Golakiya B. A. (2015). Development of Inter Simple Sequence Repeat based SCAR marker for sex determination in Carica papaya, Research Journal of Biotechnology, 10(12): 91-97.	6.28
35.	Bhadania, R. A.; Golakiya, B. A.; Akabari, D. L.; Parakhia, M.V. and Bhalani, H. N. (2015). Draft genome sequence of the Endophytic Bacterium Providencia rettgeri MR4 isolated from Abuliton indicum-A Tolerant Plant. Journal of Pure and Applied Microbiology, 9(3): 1-15.	6.00
36.	Tomar, R. S.; Parakhia, M. V.; Thakkar, J. R.; Rathod, V. M.; Padhiyar, S. M.; Thummar, V. D.; Dalal, H.; Kothari, V. V.; Kheni, J. V.; Dhingani, R. M. and Golakiya, B. A. (2016). Development of linkage map and identification of QTLs responsible for fusarium wilt resistance in castor (Ricinus communis L.), Research Journal of Biotechnology, 11(5): 67-73.	6.28
37.	Malviya, B. J.;Jadeja, V. J.; Sherathiya, H. M.; Parakhia, M. V.; Tomar, R. S.; Vaja, M. B. and Sherathia, D. N. (2016). Bioremediation of glyphosate by bacteria isolated from glyphosate contaminated soil, Journal of Pure and Applied Microbiology, 9(4): 1-5.	6.00
38.	Yusufzai, S. I.; Padhiyar, S. M.; Lende, S.,; Tomar R. S.; Thummar, V. D.; Thakkar, J. R.; Rathod V. M.; Kheni J. V.; Kothari V.; Parakhia M. V. and Golakiya B. A. (2016). Genetic diversity analysis in some marine fish species of Gujarat coast through morphological and molecular markers, Research Journal of Biotechnology, 11(3): 77-84.	6.28
Year 2016-17
1.	Gajera, H. P.; Hirpara, D. G.; Katakpara, Z. A.; Patel, S. V.; Golakiya, B. A. (2016). Molecular evolution and phylogenetic analysis of biocontrol genes acquired from SCoT polymorphism of mycoparasitic Trichoderma koningii inhibiting phytopathogen Rhizoctonia solani Kuhn. Infection, Genetics and Evolution, 45: 383–392. DOI: http://dx.doi.org/10.1016/j.meegid.2016.09.026.	9.02 (Elsevier) IF: 2.591
2.	Hirpara, D. G.; Gajera, H. P.; Bhimani, R. D. and Golakiya, B. A. (2016). The SRAP based molecular diversity related to antifungal and antioxidant bioactive constituents for biocontrol potentials of Trichoderma against Sclerotium rolfsii Scc. Current Genetics, 62: 619–641. DOI 10.1007/s00294-016-0567-5.	8.68 (Springer) IF: 2.682
3.	Gajera, H. P.; Katakpara, Z. A.; Patel, S. V. and Golakiya B. A. (2016). Antioxidant defense response induced by Trichoderma viride against Aspergillus niger Van Tieghem causing collar rot in groundnut (Arachis hypogaea L.). Microbial Pathogenesis,91: 26-34. DOI: http://dx.doi.org/10.1016/j.micpath.2015.11.010p.	7.79 (Elsevier) IF: 2.00
4.	Tomar, R. S.; Parakhia, M. V.; Rathod, V. M.; Thakkar, J. R.; Padhiyar, S. M.; Thummar, V. D.; Dalal, H.; Kothari, V. V.; Kheni, J.; Dhingani, R. M.; Sabara, P. H. and Golakiya, B. A. (2016). Molecular mapping and identification of QTLs responsible for charcoal rot resistance in Castor (Ricinus communis L.). IndustrialCrops and Products, 95: 184–190.	9.45
5.	Vaja, K. N.; Gajera, H. P.; Katakpara, Z. A.; Patel, S. V. and Golakiya, B. A. (2016). Biochemical indices and RAPD markers for salt tolerance in wheat genotypes. Indian Journal of Plant Physiology, 21(2): 143–150. (DOI 10.1007/s40502-016-0215-6).	4.66
6.	Katakpara, Z. A.; Gajera, H. P.; Vaja, K. N.; Dabhi, K. H. and Golakiya, B. A. (2016). Evaluation of heat tolerance indices in bread wheat (Triticum aestivum L.) genotypes based on physiological, biochemical and molecular markers. Indian Journal of Plant Physiology, 21(2): 197–207. (DOI10.1007/s40502-016-0222-7).	4.66
7.	Thumar, S. T.; Gajera, H. P.; Dhaduk, H. L. and Sakure, A. A. (2016). Physiological, Qualitative and Molecular Markers Based Evaluation of Mango Cultivars. Indian Journal of Agricultural Biochemistry, 29(1): 80-86.	4.03
8.	Marviya, G. V. and Vakharia, D. N. (2016). Effect of Terminal Water Stress and Benzyl Adenine on Osmoregulants in Pearl Millet [Pennisetum glaucum (L.) R.Br.] Genotypes. Indian Journal of Agricultural Biochemistry, 29(1): 9-16.	4.03
9.	Kandoliya, U. K.; Marviya, G. V.; Bodar, N. P.; Bhadja, N. V. and Golakiya, B. A. (2016). Nutritional and Antioxidant Components of Ridge Gourd (Luffa acutangula L. Roxb) Fruits of Promising Genotypes and Varieties., Scholar Journal of Agriculture and Veterinary Science, 3(5): 397-401. (eISSN:2348-1854, pISSN 2348-8883)	-
10.	Tomar, R. S.; Parakhia, M. V., Thakkar, J. R.; Rathod, V. M.; Kothari, V. V.; Acharya, R. R. and Golakiya, B. A. (2016). Assessment of genetic variability among Muskmelon (Cucumis melo L.) genotypes through biometrical trait sand molecular markers. Electronic Journal of Plant Breeding, 11(5): 215-225.	5.00
11.	Tomar, R. S.; Parakhia, M. V.; Thakkar, J. R.; Rathod, V. M.; Padhiyar, S. M.; Thummar, V. D.; Dalal, H.; Kothari, V. V.; Kheni, J. V.; Dhingani, R. M. and Golakiya, B. A. (2016). Development of linkage map and identification of QTLs responsible for fusarium wilt resistance in castor (Ricinus communis L.).Research Journal of Biotechnology, 11(5): 67-73.	6.24
12.	Yusufzai, S. I.; Padhiyar, S. M.; Lende S.; Tomar, R. S.; Thummar, V. D.; Thakkar, J. R.; Rathod, V. M.; Kheni, J. V.; Kothari, V.; Parakhia, M. V. and Golakiya, B. A. (2016). Genetic Diversity Analysis in Some Marine Fish Species of Gujarat Coast through Morphological and Molecular Markers. Research Journal of Biotechnology, 11(3): 77-84.	6.24
13.	Parakhia, M. V.; Tomar, R. S.; Vala, A. G.; Rathod, V. M. and Kheni, J. V. (2016). Whole Genome Sequencing of Drought Stress Tolerance Endophytic Bacterium Enterobacter sp. Mr1. Journal of Bacterial Mycology, 3(2): 55-58. DOI: 10.15406/jbmoa.2016.03.00055.	-
Year 2017-18
1.	Tomar R. S., Iquebal M. A., Parakhia M. V., Deepak Kumar, Jaiswal S., Rathod V. M., Padhiyar S. M., Neeraj Kumar, Rai A. and Dinesh Kumar (2017). Draft whole genome sequence of groundnut stem rot fungus Athelia rolfsii revealing genetic architect of its pathogenicity and virulence. Nature Scientific Reports, DOI:10.1038/s41598-017-05478-8.	11.23
2.	Kheni J., Kothari V., Rathod K., Rathod V., Padhiyar S., Bhalara R., Tomar R. S., Parakhiya M. V. and Golakiya B. A. (2017). Morphological and metabolic characterization of wilt disease (Fusarium oxysporum f. sp. ciceri) in chickpea (Cicer arietinum L.). Research Journal of Agriculture and Forestry Sciences, 5(7): 12-19.	7.31
3.	Mori D. S.; Kandoliya U. K.; Bhatt V. S.; Patel S. V. and Golakiya B. A. (2017). Evaluation of Phenolics and Antioxidant Enzyme Systems for Phytophthora Blight in Resistant and Susceptible Variety of Sesame (Sesamum Indicum L.). International Journal of Current Microbiology and Applied Science, 6(8): 2344-2352.	5.38
4.	Warwate S. I.; Kandoliya U. K.; Bhadja N. V. and Golakiya B. A. (2017). The Effect of Plant Growth Promoting Rhizobacteria (PGPR) on Biochemical Parameters of Coriander (Coriandrum sativum L.) Seedling. International Journal of Current Microbiology and Applied Science, 6(3): 1935-1944.	5.38
5.	Warwate S. I., Kandoliya U. K., Bhadja N. V. and Golakiya, B. A. (2017). The Effect of Seed Priming with Plant Growth Promoting Rhizobacteria (PGPR) on Growth of Coriander (Coriandrum sativum L.) Seedling. International Journal of Current Microbiology and Applied Science,6(3): 1926-1934.	5.38
6.	Rathod V. B.; Mehta D. R. and Solanki H. V. (2017). Genetic variability and divergence for oil content and yield attributes in Indian mustard [Brassica juncea (L.) Czern & Coss]. Journal of Pharmacognosy and Phytochemistry, 6(5): 1507-1509.	5.21
7.	Kapadiya K. B.; Singh C.; Bhalara R. L.; Kandoliya U. K. and Dabhi K. H. (2017). Effect of higher temperature on leaf anatomy of heat tolerance and heat susceptible wheat genotypes (Triticum aestivum L.) by scanning electron microscopy. Journal of Pharmacognosy and Phytochemistry, 6(5), 2270-2277.	5.21
8.	Hirpara D. G.; Gajera* H.P.; Hirapara J. G. and Golakiya B. A. (2017). Inhibition coeﬃcient and molecular diversity of multi stress tolerant Trichoderma as potential biocontrol agent against Sclerotium rolfsii Sacc. Infection, Genetics and Evolution, 55: 75–92. DOI: http://dx.doi.org/10.1016/j.meegid.2017.08.029	8.59 Elsevier IF:2.885
9.	Gajera* H.P.; Gevariya S. N.; Hirpara D. G.; Patel S. V. and Golakiya B. A. (2017). Antidiabetic and antioxidant functionality associated with phenolic constituents from fruit parts of indigenous black jamun (Syzygium cumini L.) landraces. Journal of Food Science and Technology, 54(10): 3180–3191. DOI: https://doi.org/10.1007/s13197-017-2756-8	7.24 (Springer) IF: 2.024
10.	Patel C. V.; Gajera* H. P.; Hirpara D. G. and Golakiya B. A. (2017). Induction of Antioxidant Enzymes and Isozymes Profile of Chickpea Genotypes Under Compatible and Incompatible Interactions with Fusarium Wilt. Journal of Plant Pathology, 99(1):131-140. DOI: http://dx.doi.org/10.4454/jpp.v99i1.3854	7.04 (Edizioni)
11.	Hirpara D. G.; Gajera H. P.; Hirpara H. Z. and Golakiya B. A. (2017). Antipathy of Trichoderma against Sclerotium rolfsii Sacc.: Evaluation of Cell Wall-Degrading Enzymatic Activities and Molecular Diversity Analysis of Antagonists. Journal of Molecular Microbiology and Biotechnology, 27: 22–28. DOI: 10.1159/000452997	7.70 (Karger) IF: 1.701
12.	Hirpara D. G.; Gajera H. P.; Hirpara H. Z. and Golakiya B. A. (2017). Molecular diversity and fingerprints of Trichoderma associated with antagonistic potentials against Sclerotium rolfsii Sacc. Journal of Plant Diseases and Protection, 124: 31–40. DOI 10.1007/s41348-016-0053-9.	6.68 (Springer) IF: 0.477
13.	Patel A. D.; Gajera H. P.; Patel S. V. and Golakiya B. A. (2017). Isolation, Identification and Molecular Characterization by RAPD of Red HE7B Dye Decolourizing Bacteria from Textile Effluents and its Cultivated Soil. Journal of Current Miocrobiology and Applied Sciences, 6(10): 1478-1484. https://doi.org/10.20546/ijcmas.2017.610.175	5.38
14.	Patel C. V.; Ramani H. R. and Gajera H. P. (2017). Genotypic study of eighteen Chickpea (Cicer arietinum L.) against Fusarium oxysporum f.sp. ciceri with the help of STMS marker using Capillary electrophoresis and Seed storage protein profiling. Research Journal of Biotechnology, 12(7): 83-89.	6.24
15.	Bharose A. A.; Gajera* H. P.; Hirpara D. G.; Kachhadia V. H. and Golakiya B. A. (2017). Molecular Identification and Characterization of Bacillus Antagonist to Inhibit aflatoxigenic Aspergillus flavus. International Journal of Current Miocrobiology and Applied Sciences, 6(3): 2466-2484. doi: https://doi.org/10.20546/ijcmas.2017.603.280	5.38
16.	Bharose A. A.; Gajera* H. P.; Hirpara D. G.; Kachhadia V. H. and Golakiya B. A. (2017). Morphological Credentials of Afla-Toxigenic and Non-Toxigenic Aspergillus Using Polyphasic Taxonomy. International Journal of Current Miocrobiology and Applied Sciences, 6(3): 2450-2465. doi: https://doi.org/10.20546/ijcmas.2017.603.279	5.38
17.	Kandoliya U. K.; Marviya G. V.; Rathod P. J.; Vakharia D. N. and Golakiya B. A. (2017). Pathogenesis Related Hydrolytic Enzymes Induction in Response to PGPR Seed Priming Against Wilt Pathogen (Fusarium oxysporum f. sp. ciceri) in Chickpea. Indian Journal of Agricultural Biochemistry. 30(2): 182-188.	4.1
18.	Timbadiya P. N., Bheda S. B., Gajera H. P. and Patel S. V. (2017). Application of Peanut Butter to Improve the Nutritional Quality of Cookies. Current research in Nutrition and Food Sciences, 5(3): online ISSN: 0973-4929.	4.04
Year 2018-19
1.	Hirpara, D. G. and Gajera H. P. (2018). Molecular heterozygosity and genetic exploitations of Trichoderma inter-fusants enhancing tolerance to fungicides and mycoparasitism against Sclerotium rolfsii Sacc. Infection, Genetics and Evolution, 66: 26-36. DOI: https://doi.org/10.1016/j.meegid.2018.09.005.	8.89 Elsevier IF: 2.885
2.	Gajera H. P. and Hirpara D. G. (2018). Anti-hyperglycemic Effect and Regulation of Carbohydrate Metabolism by Phenolic Antioxidants of Medicinal Plants against Diabetes. Current Research in Diabetes and Obesity Journal, 5(4): 555-668. DOI: 10.19080/CRDOJ.2018.05.555668.	International (Review)
3.	Raval, S.; Mahatma, M. K.; Chakraborty, K.; Bishi, S. K.; Rathod, K. J.; Jadav, J. K.; Sanghani, J. M.; Mandavia, M. K.; Singh, A. L.; Gajera, H. P. and Golakiya, B. A. (2018). Metabolomics of groundnut (Arachis hypogaea L.) genotypes under varying temperature regimes. Plant Growth Regulation, 84: 493–505. DOI: https://doi.org/10.1007/s10725-017-0356-2	8.65 (Springer) IF: 2.646
4.	Gajera H. P., Gevariya, S. N.; Patel, S. V. and Golakiya, B. A. (2018). Nutritional profile and molecular fingerprints of indigenous black jamun (Syzygium cumini* L.) landraces. Journal of Food Science and Technology, 55(2): 730-739. DOI: https://doi.org/10.1007/s13197-017-2984-y	7.26 (Springer) IF: 1.262
5.	Kapadia, D. A.; Gajera H. P., Madariya, R. B.and Golakiya, B. A. (2018). Microsatellite markers based genetic diversity in common bean (Phaseolus vulgaris* L.) genotypes. Indian Journal of Biotechnology, 17: 337-345.	6.29 NISCAIR-CSIR IF: 0.368
6.	Bharose A. A. and Gajera H. P. (2018). Antifungal Activity and Metabolites Study of Bacillus Strain Against Aflatoxin Producing Aspergillus. Journal of Applied Microbiology and Biochemistry, 18(2): 1-8. DOI: 10.21767/2576-1412.100024	iMedPub
7.	Dave, R. A.; Gajera, H. P.; Ukani, P. K.; Shihora, M. G.; Antala T. J., Pansuriya K. C., Timbadiya P. N. and Golakiya B. A. (2018). Evaluation of antioxidant activity, untargeted metabolite profile and elemental analysis of Euphorbia hirta L. International Journal of Chemical Studies, 6(3): 1986-1998.	5.31
8.	Solanki,M. V.; Trivedi S. K.; Kandoliya, U. K. and Golakiya, B. A. (2018). Effect of exogenous application of salicylic acid on biochemical constituent in black gram (Vigna mungo (L.)) Hepper irrigated with saline water. European Journal of Biotechnology and Bioscience, 6(5): 28-34.	3.21
9.	Trivedi S. K.; Solanki M. V.; Kandoliya U. K. and Golakiya B. A. (2018). Effect of exogenous application of salicylic acid on antioxidative enzymes in green gram (Vigna radiate (L.) wilczek) irrigated with saline water. International Journal of Chemical Studies. 6(4): 2668-2674. (ISSN: P- 2349–8528 E-ISSN: 2321–4902.)	5.31
10.	Solanki M. V.; Trivedi, S. K.; Kandoliya, U. K. and Golakiya, B. A. (2018). Effect of exogenous application of salicylic acid on antioxidative enzymes in black gram (Vigna mungo (L.) Hepper) irrigated with saline water.International Journal of Chemical Studies, 6(4): 2107-2116. 1591 (ISSN: P- 2349–8528 E-ISSN: 2321–4902.)	5.31
11.	Bodar, N. P.; Himanshu, D. R.; Kandoliya, U. K. and Kakhani, H. (2018). Morphological characterization of isolates novel strain of Trichoderma which accumulate the heavy metal (Cobalt). International Journal of Chemical Studies, 6(2): 1899-1902.	5.31
12.	Bodar, N. P.; Himanshu, D. R.; Kandoliya, U. K. and Kakhani, H. (2018). Effect of interspecific protoplast fusants strain (Trichoderma viride and Trichoderma koningii) on Arachis hypogaea L. for zinc tolerance using physiological and biochemical traits. International Journal of Chemical Studies, 6(2): 1586-1591. (ISSN: P- 2349–8528 E-ISSN: 2321–4902. NAAS:5.31)	5.31
13.	Bodar, N. P.; Kandoliya, U. K.; Rathod, P. J.; Bajaniya, V. K.; Bhadja, N. V. and Golakiya B. A. (2018). Biochemical changes and fatty acid profiling of consecutively used fried groundnut oil. International Journal of Chemical Studies. 6(2): 231-236. (ISSN: P- 2349–8528 E-ISSN: 2321–4902.)	5.31
14.	Goswami B. R.; Parakhia M. V.; Golakiya B. A. and Kothari C. R. (2018). Morphological and Molecular Identification of Arbuscular Mycorrhizal (AM) Fungi. International Journal of Current Microbiology and Applied Science, 7(01): 2336-2347. doi: https:// doi.org/ 10.20546 /ijcmas. 2018.701.282	5.38
15.	Bharose, A. A. and Gajera, H. P. (2018). Antifungal Activity and Metabolites Study of Bacillus Strain Against Aflatoxin Producing Aspergillus. Journal of Applied Microbiology and Biochemistry, 18(2): 1-8. DOI: 10.21767/2576-1412.100024	iMedPub
16.	Gajera, H. P.; Dave, R. A.; Anatala, T. J.; Shihora, M. G. and Golakiya, B. A. (2018).LC-QTOF based Untargeted Metabolites, Bioactive Constituents and Elemental Analysis Associated with Antioxidant Activity in Ficus racemosa L. Indian Journal of Agricultural Biochemistry, 31(1): 39-48. (doi 10.5958/0974-4479.2018.00006.0)	4.69
17.	Bhadani, R. V.; Gajera, H. P.; Hirpara, D. G.; Kachhadiya, H. J. and Patel, S. V. (2018).Biochemical Characterization and Molecular Variability Associated with Drought Tolerance in Cotton. Indian Journal of Agricultural Biochemistry, 31(1): 9-16 (doi 10.5958/0974-4479.2018.00002.3)	4.69
18.	Kandoliya, U. K.; Joshi, A. K.; Mori, D S.; Marviya, G. V. and Golakiya, B. A. (2018).Genetic diversity analysis of coconut (Cocos nucifera L.) genotypes and hybrids using molecular marker. Indian Journal of Agricultural Biochemistry, 31(1): 25-32.	4.1
19.	Joshi, A. K.; Kandoliya, U. K.; Bodar, N. P. and Golakiya, B. A. (2018). Diversity of coconut (Cocos nucifera L.) Genotypes and hybrids for root total phenol content and different enzymatic activity. Journal of Agricultural Science Research., 2(1): 13-16.	--
20.	Verma, S.; Tomar, R. S.; Rathod, V.; Thakker, J.; Shubham, Bhagwaat, N.; Raval, S.; Antala, T.; Jogia, Z. and Golakiya, B. A. (2018). Transcriptome Sequencing Analysis of Macrophomina phaseolina Resistant and Susceptible Castor Genotype. Biosciences, Biotechnology Research Asia, 15(1): 195-215.	4.93
21.	Korat, A. N.; Kavathiya, Y. A.; Lakhani, N. S.; Kandoliya, U. K. and Golakiya, B. A. (2019). Nutritional and antioxidant components of fenugreek (Trigonella foenum-graecum L.) seedlings. Journal of Pharmacognosy and Phytochemistry.,8(1): 443-447.	5.21
Year 2019-20
1.	Anuj, S. A.; Gajera, H. P.; Hirpara, D. G. and Golakiya, B. A. (2019). Bacterial membrane destabilization with cationic particles of nano-silver to combat eﬄux-mediated antibiotic resistance in Gram-negative bacteria. Life Science, 230: 178–187. DOI: https://doi.org/10.1016/j.lfs.2019.05.072	9.23 Elsevier IF: 3.234
2.	Hirpara, D. G.; Gajera, H. P.; Patel, A. K.; Katakpara, Z. A. and Golakiya, B. A. (2019). Molecular insights into development of Trichoderma* interfusants for multistress tolerance enhancing antagonism against Sclerotium rolfsii Sacc. Journal of Cell Physiology, 234: 7368–7383. DOI: https://doi.org/10.1002/jcp.27496	10.08 (Wiley) IF: 4.522
3.	Anuj, S. A.; Gajera, H. P.; Hirpara, D. G. and Golakiya, B. A. (2019). Interruption in membrane permeability of drug-resistant Staphylococcus aureus with cationic particles of nano‑silver. European Journal of Pharmaceutical Science, 127(1): 208-216. DOI: https://doi.org/10.1016/j.ejps.2018.11.005	9.47 Elsevier IF: 3.466
4.	Anuj, S. A.; Gajera, H. P.; Hirpara, D. G. and Golakiya, B. A. (2019). Bactericidal assessment of nano-silver on emerging and re-emerging human pathogens. Journal of Trace Elements in Medicine and Biology, 51(1): 219-225. DOI: https://doi.org/10.1016/j.jtemb.2018.04.028	9.23 Elsevier IF: 3.225
5.	Yadav, P. K.; Jasrotia, R. S.; Iquebal, M. A.; Bhatt, S. B.; Arora, V.; Angadi, U. B.; Tomar, R. S.; Jaiswal, S. and Kumar D. (2019). VigSatDB: genome-wide microsatellite DNA marker database of three species of Vigna for germplasm characterization and improvement. Database-The Journal of Biological Databases and Curation, 1–13. doi: 10.1093/database/baz055.	9.98
6.	Tulsani, N. J.; Hamid, R.; Jacob, F.; Umretiya, N. G.; Nandha, A. K.; Tomar, R. S. and Golakiya B. A. (2019). Transcriptome landscaping for gene mining and SSR marker development in Coriander (Coriandrum sativum L.). Genomics, 112(2): 1545-1553.	8.91
7.	Jaiswal, S.; Jadhav, P. V.; Jasrotia, R. S.; Kale, P. B.; Kad, S. K.; Moharil, M. P.; Dudhare, M. S.; Kheni, J.; Deshmukh, A. G.; Mane, S. S.; Nandanwar, R. S.; Penna, S.; Manjaya, J. G.; Iquebal, M. A.; Tomar, R. S.; Kawar, P. G.; Rai, A. and Kumar, D. (2019). Transcriptomic signature reveals mechanism of flower bud distortion in witches’-broom disease of soybean (Glycine max). BMC Plant Biology, 19: 26. doi.org/10.1186/s12870-018-1601-1	9.96
8.	Shelake, P. S.; Dabhi, M. N.; Sabat, M. and Rathod, P. J. (2019). Performance evaluation of developed low‐temperature grinding mill., Journal of Food Process Engineering, 42(8): e13290.	7.96
9.	Riddhi, P.; Purohit, H. B.; Kandoliya, U. K. and Golakiya, B. A. (2019). Effect of gibberellic acid, potassium nitrate and silicic acid on biochemical constituents and physiological parameter in cowpea (Vigna unguiculata L. Walp) seedling irrigated with saline water. International Journal of Chemical Studies, 7(6): 2162-2172	5.31
10.	Patel, R. S.; Kadam, D. D.; Kandoliya, U. K. and Golakiya, B. A. (2019). Effect of gibberellic acid, potassium nitrate and silicic acid on enzymes activity in cowpea (Vigna unguiculata L. Walp) irrigated with saline water.Journal of Pharmacognosy and Phytochemistry, 8(5): 1022-1029.	5.21
11.	Parakhia, M. V.; Tomar, R. S.; Dalal, H.; Kothari, V. V.; Rathod, V. M. and Golakiya, B. A. (2019). Genome Sequence Analysis and Identification of Genes Associated to Pesticide Degradation from Enterobacter cloacae Strain MR2. International Journal of Current Microbiology and Applied Science, 8(1): 2289-2304.	5.38
12.	Rathod, P. J.; Jithender, B.; Konga, U. and Nickhil, C. (2019). Nutritional and anti-nutritional factors present in oil seeds: An Overview.International Journal of Chemical Studies, 7(6): 1159-1165.	5.31
Year 2020-21
1.	Anuj, S. A.; Gajera, H. P.; Hirpara, D. G. and Golakiya, B. A. (2020). The impact of bacterial size on their survival in the presence of cationic particles of nano-silver. Journal of Trace Elements in Medicine and Biology, 61: 126517 online	8.90 Elsevier IF: 3.110
2.	Hirpara, D. G.; Gajera, H. P.(2020)Green synthesis and antifungal mechanism of silver nanoparticles derived from chitin- induced exometabolites of Trichoderma interfusant. Applied Organometallic Chemistry, 34: e5407	9.26 (Wiley) IF: 3.14
3.	Kandoliya, U. K.; Gajera, H. P.; Bodar, N. P. and Golakiya, B. A. 2020. Biochemical and molecular characterization of brinjal varieties and promising genotypes of Saurastra region. Journal of Pharmacognosy and Phytochemistry, 9(4): 1550-1558. DOI: https://doi.org/10.22271/phyto.2020.v9.i4v.11971	5.21
4.	Pipaliya, H. R.; Gajera H. P.; Hirpara D. G.; Khunt K. R. and Bhalara R. L. (2020). Effect of Heat Stress on Flower Anatomy of Heat Tolerance and Susceptible Chickpea (Cicer arietinum L.) Genotypes by Scanning Electron Microscopy. International Journal of Bioresource and Stress Management, 11(1): 082-088. DOI: https://DOI.ORG/10.23910/IJBSM/2020.11.1.2071a	4.65
5.	Parakhia, M. V. and Golakia, B. A. (2021) Microbiome of Groundnut (Arachis hypogaea L.) Rhizosphere Infected with Macrophomina pheseolina Root Rot. International Journal of Current Microbiology and Applied Sciences, 10(02): 141-149.	5.38
Year 2021-22
1.	Darshna G. Hirpara, Harsukh P. Gajera, Disha D. Savaliya, and Rushita V. Bhadani (2021). Characterization and bioefficacy of green nanosilver particles derived from fungicide-tolerant Tricho-fusant for efficient biocontrol of stem rot (Sclerotium rolfsii Sacc.) in groundnut (Arachis hypogaea L.). Journal of Microbiology 59 (11): 1031–1043 DOI: https://doi.org/10.1007/s12275-021-1344-9	8.90 (Springer) IF: 3.7
2.	Rushita V. Bhadani, H. P. Gajera, Darshna G. Hirpara, Harshita J. Kachhadiya, R. A. Dave (2021) Metabolomics of extracellular compounds and parasitic enzymes of Beauveria bassiana associated with biological control of whiteflies (Bemisia tabaci). Pesticide Biochemistry and Physiology 176: 104877 DOI: https://doi.org/10.1016/j.pestbp.2021.104877	10.97 (Elsevier) IF: 4.7
3.	Sandhya K. Trivedi, H. P. Gajera, D. D. Savaliya and R. V. Bhadani (2021). Biochemical and physiological changes influenced by saline water stress in chickpea (Cicer arietinum L.). Indian Journal of Agricultural Biochemistry,34 (1): 33-38. doi 10.5958/0974-4479.2021.00004.6	4.38
4.	Hiral Desai, Rasmieh Hamid, Zahra Ghorbanzadeh, Nishant Bhut, Shital M Padhiyar, Jasminkumar Kheni, and Rukam S. Tomar (2021). Genic Microsatellite Marker Characterization and Development in Little millet (Panicum sumatrense) using transcriptome sequencing. Scientific Reports, 11, 20620. https://doi.org/10.1038/s41598-021-00100-4	10.38
5.	Nidhi Radadiya, Naman Mangukia, Virali Antala, Hiral Desai, Hemangini Chaudhari, T. L. Dholaria, Rukam Singh Tomar, B. A. Golakiya and Mahesh Mahatma (2021). Transcriptome analysis of sesame-Macrophomina phaseolina interactions revealing the distinct genetic components for early defense responses. Physiology and Molecular Biology of Plants,27, 1675–1693.https://doi.org/10.1007/s12298-021-01039-6.	8.39
6.	Rakesh Nogiya, MK Mahatma, Avinash Gowda H, SS Raval, V Rathod, HP Gajera, R. S. Tomar & Narendra Kumar (2021). Changes in expression of polyamines and ethylene biosynthesis genes in groundnut (Arachis hypogaea L.) genotypes during Sclerotium rolfsii infection. Indian Journal of Experimental Biology, 58, 476-483.	6.78
7.	Balaji Rathod, Riddhi Rajyaguru, Shashikant Sharma and Rukam Singh Tomar (2021). Oil content and fatty acid profiling of soybean (Glycine max L. Merrill) of Indian cultivar. The Pharma Innovation Journal; 10(9): 24-29.	5.23
8.	Sharma, S. K., Rajyaguru, R., Gajera, H. P., Tomar, R. S., Kheni, J., Bhalani, H. and Golakiya, B. A. (2021). Optimization of in vitro regeneration protocol for tomato (Solanum lycopersicon Mill.) Cv. Junagadh Tomato-3. Journal of Cell and Tissue Research, 21(2): 7081-7090.	4.04
9.	Vasava, D. K., Kheni, J. K., Bhalani, H. N., Padhiyar, S. M., Rajyaguru, R., Desai, H. and Tomar, R. S. (2021). Mining and development of EST-SSR markers from public expressed sequence tags databases for the study of spine gourd (momordica dioica) male and female plant. Journal of Cell and Tissue Research, 21(1): 7057-7062.	4.04
10.	Tatmiya Ritisha N., Ambalam Padma and Tomar Rukam S. (2021). Metabolomics of groundnut (Arachis hypogaea L.) genotypes during groundnut- Sclerotium rolfsii interaction at different stages of infection. Research Journal of Biotechnology, 16 (4), 101-111.	4.0
11.	Saxena Akansha, Padhiyar S.M., Kheni J. and Tomar Rukam S. (2021). Character associations, path analysis and molecular characterization in Cowpea (Vigna unguiculata L.). Research Journal of Biotechnology, 16 (2), 141-148.	4.0
12.	Lenka B, Kulkarni G U, Mehta D R, Tomar R S, Mungra K D and Patel J B (2021). Combining ability studies for grain and dry fodder yield per plant in pearl millet [Pennisetum glaucum (L.) R. Br.] Using line x tester analysis over environments. The Pharma Innovation Journal; 10(12):2483-2491.	5.23
13.	Bhukya Jithender, DM Vyas, C Nickhil, PJ Rathod (2021). Development of juice extraction process for pomegranate (Punica granatum): Evaluation and physicochemical aspects. Indian Journal of Agricultural Sciences. 91 (6):936–938	6.0
14.	Neha J. Hirpara, M.N. Dabhi and P.J. Rathod. (2021). Development of Potato Starch Based Biodegradable Packaging Film. Biological Forum – An International Journal 13(1):529-541	5.11
15.	T.H Barad, Chandegara VK, Rathod P.J and Mori M.R.(2021).Quality evaluation of a jaggery prepared from developed three pan jaggery making furnace. International Journal of Chemical Studies. 9(1):907-913	--
16.	MV Solanki, PJ Rathod and MK Mahatma. (2021). Trends of antinutritional compounds in groundnut pod at development stages during drought conditions. The Pharma Innovation Journal. SP-10(10):1107-1111	5.23
17.	Charan Singh, Dhamsaniya N K, Rathod Pankajkuamr jemalbhai (2022) Effect of ultraviolet-c radiation processing on physical and microbial properties of horticulture produce. The Pharma Innovation Journal.11(6):1798-1804	5.23
18.	Sirwani, P. M., Dabhi, M. N., & Rathod, P. J. (2022). Effect of low temperature grinding on phytochemicals profile of fenugreek seed powder: Effect of grinding methods on the quality of fenugreek seed powder. Journal of Spices and Aromatic Crops, 31:(2) 177–186. https://doi.org/10.25081/josac.2022.v31.i2.7958	4.85
Year 2022-23
1.	Harshita J. Kachhadiya, H. P. Gajera, D. R. Mehta, Darshna G. Hirpara, Rushita V. Bhadani, R. A. Dave (2022). Comparative Appraisal of leaf proteomic and mass spectrometry analyses during fusarium wilt infection in resistance and susceptible genotypes of castor (Ricinus communis L.). The Protein Journal 41: 638–658. DOI: https://doi.org/10.1007/s10930-022-10083-4	10.00 (Springer) IF: 4.000
2.	Rushita V. Bhadani, H. P. Gajera, Darshna G. Hirpara, Harshita J. Kachhadiya (2022). Characterization and bio‑eicacy of entomopathogenic Beauveria associated with cuticle‑degrading enzymes to restrain sucking pest Bemisia tabaci.Parasitology Research,121: 2019–2031 DOI: https://doi.org/10.1007/s00436-022-07557-w	8.38 (Springer) IF: 2.38
3.	Rushita V. Bhadani, H. P. Gajera, Darshna G. Hirpara, D. D. Savaliya, Samir A. Anuj (2022). Biosynthesis and characterization of extracellular metabolites-based nanoparticles to control the whitely. Archives of Microbiology, 204:311 DOI: https://doi.org/10.1007/s00203-022-02917-7	8.67 (Springer) IF: 2.67
4.	H. P. Gajera, Darshna G. Hirpara, Rushita V. Bhadani, B. A. Golakiya (2022). Green synthesis and characterization of nanosilver derived from extracellular metabolites of potent Bacillus subtilis for antifungal and eco-friendly action against phytopathogen. Biometals 35: 479–497. DOI: https://doi.org/10.1007/s10534-022-00382-9	9.38 (Springer) IF: 3.38
5.	M. N. Dabhi, P. R. Davara, H. P. Gajera, Nirav Joshi, and Parth Saparia (2022). Bioactive Compounds of Turmeric Powder Affected by Grinding Method and Feed Temperature. International Journal of Agriculture, Environment and Biotechnology*, 15 (Special Issue): 337-345. DOI: 10.30954/0974-1712.03.2022.8	4.54
6.	Harsh B. Purohit, H. P. Gajera, D. D. Savaliya and Darshna G. Hirpara (2022). Physiological and Biochemical changes during in vitro germination under salinity stress in groundnut (Arachis hypogaea L.). The Pharma Innovation Journal, 11(7): 55-63.	5.23
7.	Nimisha V Hirani, H. P. Gajera, Darshna G. Hirpara and R. L. Bhalara (2022). Microbiome characterization of PGPR isolated from Fusarium wilt infected cumin Rhizosphere. The Pharma Innovation Journal, 11(8): 1115-1126.	5.23
8.	Kinjal M. Hirapara, H. P. Gajera, D. D. Savaliya and D. G. Hirpara (2022). Biochemical and physiological changes influenced by drought stress in chickpea (Cicer arietinum L.). Indian Journal of Agricultural Biochemistry, 35 (1), 79-86. doi 10.5958/0974-4479.2022.00012.0	4.38
9.	Khushbu A. Thummar, Sandhya K. Trivedi, H. P. Gajera and D. D. Savaliya (2022). Antioxidant defence system induced by seed priming with nanoparticles to restrain Fusarium wilt in cumin (Cuminum cyminum L.). Indian Journal of Agricultural Biochemistry, 35 (1): 27-34. doi 10.5958/0974-4479.2022.00004.1	4.38
10.	C. Tara Satyavathi, Rukam S. Tomar, Supriya Ambawat, Jasminkumar Kheni, Shital M. Padhiyar, Hiralben Desai, S.B. Bhatt, M. S. Shitap, Ramesh Chand Meena, S. Mukesh Sankar, S.P. Singh and Vikas Khandelwal (2022). Stage Specific Comparative Transcriptomic Analysis to Reveal Gene Networks Regulating Iron and Zinc Content in Pearl Millet [Pennisetum glaucum (L.) R. Br.]. Scientific Reports, 12:276. https://doi.org/10.1038/s41598-021-04388-0	10.38
11.	Ashish Vala, Nasreen Bano, Yogita Deshmukh, Rukam S. Tomar, CG Joshi, N Subhash (2022). Transcriptome analysis identifies novel gene (s) and pathways for salt stress responses in Dandi cultivar. Cereal Research Communications, https://doi.org/10.1007/s42976-022-00319-5.	7.20
12.	Likhindra Reang, Shraddha Bhatt, Rukam S. Tomar, Kavita Joshi, Shital Padhiyar, U. M. Vyas & Jasmin Kumar Kheni(2022). Plant growth promoting characteristics of halophilicand halotolerant bacteria isolated from coastal regions of Saurashtra Gujarat. Scientific Reports, 12:4699. https://doi.org/10.1038/s41598-022-08151-x	10.38
13.	Jalaja S. Menon, Berin Pathrose, A. C. Asna, Rukam S. Tomar and B. Dineshkumar (2022). Morphological, biochemical, molecular marker, GC-MS analysis of garlic (Allium sativum L.) landraces in the rain shadow high hills of Kerala. Pharmacognosy Magazine, 18(77):121-127. DOI:10.4103/pm.pm_435_21	7.10
14.	Rukam S. Tomar, Ramesh K. Solanki, M. A. Iquabal, S. M. Padhiyar, and J. K. Kheni (2022). Deciphering Chloroplast Genome of Indian Cultivar Gujarat Cumin 4: First Report. Annals of Arid Zone, 61(1): 71-74.	4.70
15.	Chauhan K. P., Kulkarni G. U., Sharma L. K., Patel J. B., Babariya C. A. and Tomar R. S. (2022). Impact of apical pinching and fruit picking on seed quality parameters of okra (Abelmoschus esculentus (L.) Moench). The Pharma Innovation Journal; 11(11): 490-492.	5.23
16.	Hemangini A Chaudhari, Antala Virali, Nidhi Radadiya, Mahesh Kumar Mahatma and Rukam S. Tomar (2022). Selection of suitable reference gene for gene expression studies during groundnut seed germination. Research Journal of Biotechnology, 17(2), 64-71.	4.00
17.	Chander Kanta Kumawat, G.U. Kulkarni , R. S. Tomar , B.A. Monapara, A.G. Pansuriya and L.K. Sharma (2022). Per Se Performance of Brinjal (Solanum melongena L.) Hybrids for Fruit Yield and its component Traits under Normal and Organic Environments. Biological Forum – An International Journal, 14(4): 441-448.	5.11
18.	Khaniya J, GU Kulkarni, BA Monpara, DR Mehta, LK Sharma and R. S. Tomar (2022). Narrow-sense heritability and genetic advance for seed yield and yield attributing traits in medium duration pigeonpea [Cajanus cajan (L.) Mill sp.]. The Pharma Innovation Journal, 11(9): 413-417.	5.23
19.	Dhawale R N, Padhiyar Shital M, Kheni Jasminkumar and Tomar R. S. (2022). Metabolomic profiling of drought-tolerant little millet (Panicum sumatrense L.) genotype in response to drought stress. The Pharma Innovation Journal, 11(4): 1754-1762.	5.23
20.	Tomar Rukam S, RK Solanki, SM Padhiyar, JV Kheni and RK Kakani (2022). Flow cytometric genome size estimation of major seed spice grown in India. The Pharma Innovation Journal, 11(6): 507-510.	5.23
21.	Pappy Ready, Pritesh Sabara, Shital M. Padhiyar, Kulkarni, G. U., J. V. Kheni and Rukam S. Tomar (2022). Genetic Diversity of Groundnut (Arachis hypogaea L.) revealed by RAPD and ISSR Markers. Annals of Arid Zone, 60(3&4): 109-115.	4.70
22.	Shital M Padhiyar, Jasminkumar Kheni, Hiral V Desai, Rukam S. Tomar and H. P. Gajera (2022). Metabolomic characterization of barnyard millet (Echinochloa frumentacea L.) involved in different stages of spike development. The Pharma Innovation Journal, 11(6): 604-611.	5.23
23.	V.M. Sejani, N.K. Dhamsaniya, P.J. Rathod (2022) Preparation of Peanut Flour based Thabdi Peda. Journal of Dairying, Foods & Home Sciences. 42(2): 237-241	5.75
24.	V.M. Sejani N.K. Dhamsaniya and P.J. Rathod (2022) Effect of Peanut Flour on Proximate Composition ofThabdi Peda.Biological forum-An International Journal.14(3):1052-1057 ISSN No. (Print): 0975-1130	4.54
25.	Bhukya Jithender, D. M. Vyas, Nickhil C, P. J. Rathod (2022). Optization of Developed Continuous Type Pomegranate Juice Ex- tractor AGRICULTURAL MECHANIZATION IN ASIA, AFRICA AND LATIN AMERICA(53)65-72	6.14
26.	Shingala Abhishaben M, Dabhi MN, Rathod PJ, Dharsenda T L (2022) .Effect of ozone gas exposure time and ozone cycle on starch content of wheat (Triticum aestivum) during bulk storage. The Pharma Innovation Journal .11(10):1621-1626	5.23
27.	VB Gore, PJ Rathod, AG Vala, D Kumar (2022) Analysis of protein profiling through SDS-PAGE of spreading types varieties of groundnut grown in India. The Pharma Innovation Journal.1(9):2811-2817	5.23
28.	Shingala, A.M, Dabhi, M.N., Rathod, P.J, Rathod R.R (2022) Influence of Ozone Treatment on Carbohydrate Content of Wheat (Triticum aestivum) during Bulk Storage Int. J. Ag. Env. Biotech. 15 (1)401-406..	5.23
29.	Charan Singh, Dhamsaniya N K, Rathod Pankajkumar Jemalbhai (2022)Effect of Ultraviolet-C Irradiation on Storability of Sapota.Biological Forum – An International Journal 14:(3)194-198	4.54
30.	V.M. Sejani, N.K. Dhamsaniya, P.J. Rathod (2022) Preparation of Peanut Flour based Thabdi Peda. Journal of Dairying, Foods & Home Sciences. 42(2): 237-241	5.75
Year 2023-24
1.	Khyati R. Savani; H. P. Gajera; Darshna G. Hirpara; Disha D. Savaliya; U. K. Kandoliya (2023). Salicylic acid-functionalised chitosan nanoparticles restore impaired sucrose metabolism in the developing anther of cotton (Gossypium hirsutum) under heat stress. Functional Plant Biology, on line DOI: https://doi.org/10.1071/FP22309	8.81 (CSIRO Publishing) IF: 3.000
2.	H. P. Gajera, Darshna G. Hirpara, Disha D. Savaliya, M. V. Parakhia (2023). Biochemical and molecular depictions to develop ech42 gene‑ specific SCAR markers for recognition of chitinolytic Trichoderma inhibiting Macrophomina phaseolina (Maubl.) Ashby. Archives of Microbiology, 205 (6): 242 on line DOI: https://doi.org/10.1007/s00203-023-03582-0	8.67 (Springer) IF: 2.667
3.	Darshna G. Hirpara and Harsukh P. Gajera (2023). Intracellular metabolomics and microRNAomics unveil new insight into the regulatory network for potential biocontrol mechanism of stress‐tolerant Tricho‐fusants interacting with phytopathogen Sclerotium rolfsii Sacc. Journal of Cellular Physiology 238 (6): 1288-1307 DOI: https://doi.org/10.1002/jcp.31009	12.51 (Wiley) IF: 6.513
4.	Darshna G. Hirpara, H. P. Gajera, Disha D. Savaliya, M. V. Parakhia (2023). Exploring conserved and novel MicroRNA-like small RNAs from stress tolerant Trichoderma fusants and parental strains during interaction with fungal phytopathogen Sclerotium rolfsii Sacc. Pesticide Biochemistry and Physiology 191: 105368 DOI: https://doi.org/10.1016/j.pestbp.2023.105368	10.97 (Elsevier) IF: 4.966
5.	Smrutirekha Sahu, UK Kandoliya and HP Gajera (2023). Evaluating the impact of iron oxide nanoparticles on nutritional parameters and yield attributes of groundnut grown in calcareous soils. The Pharma Innovation Journal, 12(9): 2246-2250.	5.23
6.	Tajender Kumar, Timbadiya P. N., Kandoliya U. K., Parakhia M. V. and Gajera H. P. (2023). Assessing the Nutritional and Antinutritional Components of Promising Kabuli Chickpea (Cicer arietinum L.) Genotypes, International Journal of Economic Plants, 10(2): 122-126. Doi: HTTPS://DOI.ORG/10.23910/2/2023.0517	4.37
7.	Ashish Chovatiya, Riddhi Rajyaguru, Rukam Singh Tomar and Preetam Joshi (2023). Revolutionizing Agriculture: Harnessing CRISPR/Cas9 for Crop Enhancement. Indian Journal of Microbiology, https://doi.org/10.1007/s12088-023-01154-w	9.00
8.	VishaRathod, Khyati Rathod, Rukam S. Tomar, Ritisha Tatamiya, Rasmieh Hamid, Feba Jacob and Nasreen Shakil Munshi (2023). Metabolic profiles of peanut (Arachis hypogaea L.) in response to Puccinia arachidis fungus infection. BMC Genomics 24, 630. https://doi.org/10.1186/s12864-023-09725-3	10.55
9.	Shital M. Padhiyar, Jasminkumar Kheni, Hiral Desai and Rukam S. Tomar (2023). Comparative transcriptome profiling of high and low grain-iron containing Indian barnyard millet (Echinochloa frumentacea L.) genotypes during different stages of grain development. Haliyon	10.00
10.	Riddhi Rajyaguru and Rukam S. Tomar (2023). Induction of new allelic variant of AhFAD2B gene in peanut cultivar, GG20 through CRISPR/Cas9-mediated mutagenesis. Journal of Plant Biochemistry and Biotechnology	7.52
11.	Ramesh Narayanrao Dhawale, Rukam Singh Tomar, Shital Padhiyar, Jasminkumar Kheni, Gulwe Ashish and Sunil Tulahiram Hajare (2023). De Novo transcriptome Sequencing and Metabolic profiling of Drought tolerance associated genes in little Millet (Panicum sumatrense L.). Functional and Integrative Genomics, 23:303. https://doi.org/10.1007/s10142-023-01221-x	9.67
12.	Hemangini A. Chaudhari, Mahesh Kumar Mahatma, Virali Antala, Nidhi Radadiya, Piyush Ukani, Rukam Singh Tomar, Lokesh Kumar Thawait, Sushmita Singh, K. Gangadhara, Amar Sakure and Akrash Parihar (2023). Ethrel-induced release of fresh seed dormancy causes remodeling of amylase activity, proteomics, phytohormone, and fatty acid profile of groundnut (Arachis hypogaea L.). Physiology and Molecular Biology of Plants, https://doi.org/10.1007/s12298-023-01332-6	9.50
13.	Srutiben A Gundaraniya, Padma Ambalam, Roli Budhwar, Shital M Padhiyar and Rukam S. Tomar* (2023). Transcriptome analysis provides insights into the stress response in cultivated peanut (Arachis hypogaea L) subjected to drought stress. Molecular Biology Report, https://doi.org/10.1007/s11033-023-08563-6	8.74
14.	Nikita S. Patel, Jagdish. B. Patel and Rukam. S. Tomar (2023). Identification of heat tolerant bread wheat (Triticum aestivum L.) genotypes through heat susceptibility index (HSI) and SSR markers. Cereal Research Communications, https://doi.org/10.1007/s42976-023-00426-x	7.77
15.	Chintan Kapadia, Rahul Datta, Saiyed Mufti Mahammad, Rukam Singh Tomar, Jasmin Kumar Kheni, and Sezai Ercisli(2023). Genome-wide identification, quantification, and validation of differentially expressed miRNAs in Eggplant (Solanum melongena L.) based on sequencing of small RNA sequences in response to Ralstonia solanacearum infection. ACS Omega, DOI: 10.1021/acsomega.2c07097	10.13
16.	Pappy Ready, Pritesh Sabara, Shital M. Padhiyar, Kulkarni, G. U. and Rukam S. Tomar (2023). Correlation and path analysis in groundnut (Arachis hypogaea L.) genotypes through agro-morphological study. Annals of arid zone, 62(3): 227-234.	4.70
17.	Ashish G. Vala, Rukam Singh Tomar, Pankaj J. Rathod, and Rajivkumar (2023). Speed Breeding: Accelerating Crop Improvement through Controlled Environments, Genetics, and High-Throughput Phenotyping. International Advanced Research Journal in Science, Engineering and Technology, 10(5), 746-749.	4.00
18.	Ashish Vala, Nasreen Bano, Yogita Deshmukh, Rukam S. Tomar, CG Joshi, N Subhash (2023). Genomics Approaches for Enhancing Abiotic Stress Tolerance in Groundnut: A Pathway to Crop Improvement. International Journal of Science and Research Archive,	4.00
19.	Shital M. Padhiyar, H.P. Supreeth, R.K. Solanki, K.D. Mungra and Rukam S. Tomar (2023). Assessment of Molecular Diversity Among Pearl Millet [Pennisetum glaucum (L.) R. Br.] Maintainer (B) and Restorer Lines. Annals of Arid Zone 62(1): 55-63	4.70
20.	Meniya V.H., Shital M. Padhiyar, Hiral Desai, Jasminkumar Kheni and Rukam S. Tomar (2023). Development and Validation of Microsatellite Markers for Barnyard Millet Obtained by Partial Genome Assembly. Annals of Arid Zone 62(1): 83-89	4.70
21.	Vaibhav Vyas, Paresh Davara, Ashish Joshi, Mukesh Dabhi, Pankajkumar Rathod and Parthkumar Sapariya (2023). Physical and sensory properties of peanut sauce prepared through fermentation process.The Pharma Innovation Journal12(5): 2620-2625	5.23
22.	V. B. Gore, P. J. Rathod, A. G. Vala, Gulla Bhavitha, D. Kumar (2023). Fatty acid profiling through GC-MS in oil extracted from thirty varieties of groundnut grown in Gujarat, India. Emergent Life Sciences Research 9(1):149-158	5.75
23.	NU Joshi, MN Dabhi and PJ Rathod (2023). A review on factors affecting Dehusking operation of different agricultural products. The Pharma Innovation Journal SP-12(11): 478-482	5.23
24.	Chandani Popalia, VK Chandegara, PJ Rathod. (2023). Valorization of sweet orange peel by fluidized bed drying and cryogenic grinding: Colour characteristics evaluation. Pharma Innovation 12(5):1149-1154.	5.23
25.	Sejani V.M., Dhamsaniya N.K., Rathod P.J. (2023).Preparation of peanut flour based Thabdi peda. Asian Journal of Dairy and Food Research 42(2):237-241	5.5
26.	Amiben, Lakhani and Benharlal, P. S and Kandoliya, U. K. (2024) Partial Chemical Characterization of Drought-Related Metabolites in Maize Under Drought Stress Conditions. International Journal of Environment and Climate Change, 14 (1). pp. 338-348. ISSN 2581-8627	5.13
27.	Hinal Patoliya, UK Kandoliya, HP Gajera, PK Ukani. (2024) The effect of Gibberellic acid, Abscisic acid and salicylic acid on Metabolome profiling in wheat (Triticum aestivum L.) irrigated with saline water. Int J Adv Biochem Res. 8(1S):373-380.	5.29

Papers Presented in Seminar/Symposia

Sr. No.	Details of Publication
1.	Gajera, H. P.; Hirpara, D. G.; Patel, D. S. and Golakiya, B. A. (2016). Green synthesis and characterization of nanoparticles derived from potent Bacillus antagonist for biocontrol activity against Fusarium wilt in cumin. International Conference on "Nutraceuticals and Functional Foods- The Challenges and Opportunities”, Anand, AAU, Dec. 6-8, Pp. 30
2.	Gajera, H. P.; Hirpara, D. G.; Gevariya, S. N. and Golakiya, B. A. (2016). Nutraceutical, antioxidant and antidiabetic potentials associated with fruit size of indegeouns black jamun (Syzygium Cumini L.) landraces. International Conference on "Nutraceuticals and Functional Foods- The Challenges and Opportunities”, Anand, AAU, Dec. 6-8, Pp. 49.
3.	Katakpara, Z. A.; Savaliya, D. D.; Gajera, H. P. and Patel S. V. (2016). Characterization of eugenol for therapeutic potential derived from Tulsi (Ocimum sanctum L.) leaves. International Conference on "Nutraceuticals and Functional Foods- The Challenges and Opportunities”, Anand, AAU, Dec. 6-8, Pp. 102.
4.	Hirpara, D. G.; Gajera, H. P.; Hirpara, J. G. and Golakiya, B. A. (2016). In vitro antifungal activities against Sclerotium rolfsii and molecular diversity in Trichoderma strains using SRAP markers. International Conference on "Nutraceuticals and Functional Foods- The Challenges and Opportunities”, Anand, AAU, Dec. 6-8, Pp. 123.
5.	Hirpara, D. G.; Gajera, H. P.; Vaja, K. N.; Patel, D. S. and Golakiya, B. A. (2016). GC-MS based characterization of bioactive constituents attained from Trichoderma biocontrol agent inhibiting Sclerotium rolfsii in groundnut. International Conference on "Nutraceuticals and Functional Foods- The Challenges and Opportunities”, Anand, AAU, Dec. 6-8, Pp. 124.
6.	Gajera, H. P.; Savaliya, D. D.; Vaja, K. N. and Golakiya, B. A. (2016). Biochemical characterization of phosphate solubilizing bacteria isolated from soil rhizosphere. International Conference on "Nutraceuticals and Functional Foods- The Challenges and Opportunities”, Anand, AAU, Dec. 6-8, Pp. 128.
7.	Rathod, V. B.; Solanki, H. V.; Gajera, H. P.; Mehta, D. R. and Golakiya, B. A. (2016). Genetic variability and divergence for oil content and yield attributes in Indian mustard [Brassica juncea (L.) CZERN & COSS]. International Conference on "Nutraceuticals and Functional Foods- The Challenges and Opportunities”, Anand, AAU, Dec. 6-8, Pp. 176.
8.	Vaja, K. N.; Gajera, H. P.; Vaja, V. N. and Golakiya, B. A. (2016). Nutritional quality and genetic diversity related to salinity tolerance in wheat genotypes. International Conference on "Nutraceuticals and Functional Foods- The Challenges and Opportunities”, Anand, AAU, Dec. 6-8, Pp. 177.
9.	Katakpara, Z. A.; Gajera, H. P.; Dabhi, K. H. and Golakiya, B. A. (2016). Assessment of seed quality and microsatellite markers for heat tolerance in bread wheat (Triticum aestivum L.). International Conference on "Nutraceuticals and Functional Foods- The Challenges and Opportunities”, Anand, AAU, Dec. 6-8, Pp. 191.
10.	Vaja, K. N.; Gajera, H. P.; Hirpara, D. G. and Golakiya, B. A. (2016). Molecular diversity of Pseudomonas contributed to PGPR and biocontrol activity against phytopathogens. International Conference on "Nutraceuticals and Functional Foods- The Challenges and Opportunities”, Anand, AAU, Dec. 6-8, Pp. 192
11.	Gajera, H. P.; Bhadani, R. V.; Patel, S. V. and Golakiya, B. A. (2016). Genetic diversity analysis among promosing genotypes and cultivars of cowpea (Vigna unguiculata L.) using molecular markers. International Conference on "Nutraceuticals and Functional Foods- The Challenges and Opportunities”, Anand, AAU, Dec. 6-8, Pp. 192.
12.	Savaliya, D. D.; Katakpara, Z. A.; Gajera, H. P. and Golakiya B. A. (2016). Influence of brassinolide on isozymes profiling and seed quality of groundnut (Arachis hypogaea L.) cultivars under water deficit stress. International Conference on "Nutraceuticals and Functional Foods- The Challenges and Opportunities”, Anand, AAU, Dec. 6-8, Pp. 193.
13.	Marviya, G.V.; Kandoliya, U. K.; Golakiya, B. A. and Vakharia, D. N. (2016). Role of Benzyl Adenine on Enzyme Activities in Pearl Millet [Pennisetum Glaucum (L.) R.Br.] Genotypes under PEG Induced Stress', in InternationalConferenceon “NutraceuticalsandFunctionalFoods:The ChallengesandOpportunities” (ICNFF-16-ISAB) along withXIIIConvention oftheIndianSocietyofAgriculturalBiochemists during December6to8,2016 at Department ofBiochemistry, B.A.CollegeofAgriculture, Anand Agricultural University,Anand-388110,INDIA. Abstrct in ICNFF-2016-ISAB, P.224-225.
14.	Kandoliya, U. K.; Marviya, G. V.; Rathod, P. J.; Vakharia, D. N. and Golakiya, B. A. (2016). Pathogenesis related hydrolytic enzymes induction in response to PGPR seed priming against wilt pathogen (Fusarium oxysporum f.Sp. Ciceri) in Chickpea., in InternationalConferenceon “NutraceuticalsandFunctionalFoods:The ChallengesandOpportunities” (ICNFF-16-ISAB) along withXIIIConvention oftheIndianSocietyofAgriculturalBiochemists during December6to8,2016 at Department ofBiochemistry, B.A.CollegeofAgriculture, Anand Agricultural University,Anand-388 110,INDIA. Abstrct in ICNFF-2016-ISAB, P.224-225
15.	Chahwala, F. D.; Tomar, R. S.; Padhiyar, S. M.; Kheni, J. and Desai, H. (2019). presented paper at 9th International Geminivirus Symposium and 7thInternational ssDNA Comparative Virology Workshop on “Exploration of defence mechanism involved in solanum lycopersicum by using high throughput RNA-Seq method against begomovirus infection.” at UC Davis, Davis, California, USA form 9th November to 13th November 2019 with the funding from DBT.
16.	Tomar, R. S. (2019). presented a paper on “Partial genome and transcriptome sequencing in minor millets for the discovery of SSR and EST-SSR markers” at National Institute of Plant Genome research (NIPGR), New Delhiin a National Conference on “Neglected and Underutilized Crop Species” held on August 2nd, 2019.
17.	Desai, H.; Padhiyar, S. M.; Humbal, N. V.; Meniya, V. H.; Bhut, N.; Kheni, J.; Chahwala, F. D. and Tomar, R. S. (2019). presented a poster on “Genetic diversity in the minor millet germplasms revealed by simple sequence repeat markers” at National Institute of Plant Genome research (NIPGR), New Delhiin a National Conference on “Neglected and Underutilized Crop Species” held on August 2nd, 2019.

Other Publication viz Books, Book chapter, Practical Manuals, Bulletins etc.

Sr. No.	Details of Publication
Year 2015-16
1.	Gajera, H. P.; Patel, S. V. And Golakiya, B. A. (2015). Biochemistry, Molecular Biology and Biotechnology - Instant Notes. New India Publishing Agency, New Delhi, pp. 372, ISBN: 978-93-83305-52-0.
2.	Antala, T. J.; Gajera, H. P. and Vyas, H. R. (2015). Molecular and Biochemical marker for Fingerprinting: Cowpea. LAP lambert Academic Publishing, Deutschland/Germany, ISBN: 978-3-659-23612-0.
3.	Gajera, H. P.; Kapopara, M. B. and Antala, T. J. (2015). Peanut Butter: Nutritional Concepts to Fortify Confectionaries. LAP lambert Academic Publishing, Deutschland/Germany, ISBN: 978-3-659-38919-1.
4.	Gajera, H. P.; Savaliya, D. D. and Antala, T. J. (2015). Eugenol: Therapeutic Potential of Tulsi (Osimum sanctum L.) LAP lambert Academic Publishing, Deutschland/Germany, ISBN: 978-3-659-51337-4.
5.	Gajera, H. P.; Dave, R. A. and Chavda, J. S. (2015). Curcuminoids: Antioxidant Potentials and Medicinal Uses.LAP lambert Academic Publishing, Deutschland/Germany, ISBN: 978-3-659-53422-5.
6.	Gajera, H. P.and Golakiya, B. A. (2015). In: Raghvani, K. K.; Jethva, D. M. and Vyas, U. M. (Eds.) Biochemical and Molecular Basis of Plant Defense Mechanism Induced by Biocontrol agent.On line E-Manual Designed and Developed By Division of Computer Applications, IARI, New Delhi, on CBP-IASRI portal, pp. B-17-25. (http://http://cbp.icar.gov.in/ebook22.aspx?trainingApprovedId=WS-2015-1085)
7.	Kandoliya, U. K. and Golakiya, B. A. (2015). In:Raghvani, K. K.; Jethva, D. M. and Vyas, U. M (Eds.). Role of secondary metabolites in plant pathogenesis and Defense mechanism. On line E-Manual Designed and Developed By Division of Computer Applications, IARI, New Delhi, on CBP-IASRI portal, pp. B-1-9. (http://http://cbp.icar.gov.in/ebook22.aspx?trainingApprovedId=WS-2015-1085)
8.	Marviya, G. V. and Golakiya, B. A. (2015). In: Raghvani, K.K.; Jethva, D.M. and Vyas, U.M. (Eds.) DNA Isolation and Utilization of Biotechnological Methods viz. SSR, RAPD etc. For Identification, Comparison and Sequencing of Genes. On line E-Manual Designed and Developed By Division of Computer Applications, IARI, New Delhi, on CBP-IASRI portal. pp. B-26-43. (http://http://cbp.icar.gov.in/ebook22.aspx ?trainingApprovedId=WS-2015-1085)
9.	Gajera, H. P. (2015). Practical manual for Basic Biochemistry. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
10.	Marviya, G. V.; Rathod, P. J. and Kandoliya, U. K. (2015). Practical manual on Elementary plant Biochemistry and Biotechnology. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
11.	Marviya, G. V. (2015). Practical manual on Fundamentals of Food Technology. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
12.	Rathod, P. J.; Kandoliya, U. K. and Marviya, G. V. (2015). Practical manual on Biochemistry. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
13.	Rathod, P. J. (2015). Food & Nutritional Biochemistry. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
14.	Rathod, V. B. (2015). Lecture Notes and Practical manual on Principles of plant Breeding. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
Year 2016-17
1.	Bajaniya V. K.; Bhadja N. V. and Kandoliya U. K. (2016). Physicochemical and Fatty acids Properties of Bili and Khakhara oils. LAP Lambert Academic Publishing, ISBN. No. 978-3-659-89879-2.
2.	Hirpara, D. G.; Gajera, H. P. and Patel, A. K. (2016). Molecular perspectives of Trichoderma strains inhibiting S. rolfsii. LAP Lambert Academic Publishing, ISBN: 978-3-330-00541-9.
3.	Gajera, H. P.; Savaliya, D. D.; Hirapara, D.G.; Patel, S.V. and Golakiya, B. A. (2016). In: Kumar, P.; Gupta, V. K.; Tiwari, A. K. and Kamale, M. (Eds.). Biocontrol Mechanism of Bacillus for Fusarium Wilt Management in Cumin (Cuminum cyminum L.).(Book chapter in Current trends in plant disease diagnostics and management practices.) Springer Nature, Ag Switzerland, pp. 29-47, ISBN No. 978-3-319-27312-9. DOI: 10.1007/978-3-319-2732-9
4.	Rathod, P. J.; Marviya, G. V. and Kandoliya, U. K. (2016). Practical manual on Advances in biochemistry and Biotechnology of flower crops. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
5.	Vala, A. G. and Marviya, G. V. (2016). Practical manual For ELP of tissue culture technology. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
6.	Marviya, G. V. (2016). Fundamentals of Food and Nutrition. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
7.	Parakhia, M. V. (2016). Practical Manuals on Introductory Microbiology. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
8.	Rathod, V. B. (2016). Lecture Notes on Molecular Breeding. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
9.	Rathod, V. B. (2016). Practical manual on Techniques in Molecular Biology-II. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
10.	Gajera, H. P.; Kandoliya, U. K. and Golakiya, B. A. (2016). Detection of Adulteration and Microbial contaminants in Milk And Milk Products. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
Year 2017-18
1.	Gajera, H. P. (2017). Practical manual for Basic Biochemistry. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
2.	Rathod, P. J. (2017). Biochemistry of Cereals oilseeds and pulses Fundamental of Food and Nutritional Biochemistry, Advances in Biochemistry and Biotechnology of flower crops, Advances in Biochemistry and Biotechnology of vegetables crops. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
3.	Hirpara, D. G. and Gajera, H. P. (2017). Quorum Sensing Enables Bacteria to Communicate, Readers shelf, 13(11): 53-55.
4.	Hirpara, D. G. and Gajera, H. P. (2017). Dynamics of Nanobiotechnology for Protection and Nutrition of Crop Plants, Readersshelf, 12: 39-41.
5.	Rathod, V. B.; Rathod, P. J. and Katakpara, Z. A. (2017). Union budget: 2017-2018 - Budget for better agriculture. Indian Farmer, 4(10): 760-762.
6.	Hirpara, D. G. and Gajera, H. P. (2018). Quorum Quenching: Implications of Novel Antimicrobial Therapeutics to Control Infectious Diseases, Readersshelf, 14(05): 04-06.
Year 2018-19
1.	Gajera, H. P. (2018). Practical manual on principle of Biotechnology. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
2.	Vala, A. G. and Parakhia, M. V. (2018). Practical manual on introductory biotechnology. Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh.
Year 2020-21
1.	Riddhi Rajyaguru, Nataraja Maheshala, Chandrashekar Mootapally, Neelam Nathani, Rukam Singh Tomar, Hiren Bhalani, Priyanka Sharma (2021). CRISPR-Cas9 Approaches to Enhance Contents of Plant Secondary Metabolites. In: Mohd. Shahnawaz (ed), Biotechnological Approaches to Enhance Plant Secondary Metabolites: Recent Trends and Future Prospects, CRC Press, Taylor & Francis Group, USA.
2.	Vishnu D Rajput, Abhisek Singh, Ragini Sharma, Sapna Rawat and Rukam S. Tomar (2021). Impact of emerging tools for solving 'Hidden hunger' in Humans. In: Vishnu D Rajput & Abhishek Singh (eds.), Emerging Tools for Sustainable Agriculture and Food Security. Nova Science Publishers, Inc.
3.	Abhisek Singh, Vishnu Rajput, Sapna Rawat and Rukam S. Tomar (2021). Emerging tools for sustainable agriculture and food security. In: Vishnu D Rajput & Abhishek Singh (eds.), Emerging Tools for Sustainable Agriculture and Food Security. Nova Science Publishers, Inc.
4.	Zahra Ghorbanzadeh, Feba Jacob Thoppurathu, Rasmieh Hamid, Rukam S. Tomar and Mohammad Reza Ghaffari (2021). Biotechnology and Genetic engineering tools for abiotic stress management. In: Vishnu D Rajput & Abhishek Singh (eds.), Emerging Tools for Sustainable Agriculture and Food Security. Nova Science Publishers, Inc.
5.	Sara Asadi, Feba Jacob, Rasmieh Hamid, Rukam S. Tomar and Zahra Ghorbanzadeh (2021). Advance Microbiological Applications For Sustainable Agriculture. In: Vishnu D Rajput & Abhishek Singh (eds.), Emerging Tools for Sustainable Agriculture and Food Security. Nova Science Publishers, Inc.
Year 2021-22
1.	Riddhi Rajyaguru, Nataraja Maheshala, Chandrashekar Mootapally, Neelam Nathani, Rukam Singh Tomar, Hiren Bhalani, Priyanka Sharma (2021). CRISPR-Cas9 Approaches to Enhance Contents of Plant Secondary Metabolites. In: Mohd. Shahnawaz (ed), Biotechnological Approaches to Enhance Plant Secondary Metabolites: Recent Trends and Future Prospects, CRC Press, Taylor & Francis Group, USA.
2.	Rathod P.J. (2021). Practical Manual for Biochem 509 Food and Nutritional Biochemistry, Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh
3.	Rathod P.J. (2021). Practical Manual for Biochem 511 Biochemistry of cereals , oilseeds and pulses, Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh
4.	Rathod P.J. (2021). Practical Manual for Biochem 509 Nutritional Biochemistry (5th dean), Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh
5.	Sara Asadi, Feba Jacob, Rasmieh Hamid, Rukam S. Tomar and Zahra Ghorbanzadeh (2021). Advance Microbiological Applications For Sustainable Agriculture. In: Vishnu D Rajput & Abhishek Singh (eds.), Emerging Tools for Sustainable Agriculture and Food Security. Nova Science Publishers
Year 2022-23
1.	Rie Horiuchi, Ram B. Singh, Toru Takahashi, Saikat Kumar Basu, Rukam S. Tomar, Wajdy Al-Awaida, Harpal S. Buttar and Miki Tokunaga (2022). Epigenetic modulation of nutritional factors with reference to microgravity conditions for plants and animals: a new biotechnological approach for developing functional foods. In: Ram B. Singh, Shaw Watanabe, and Adrian Isaza (eds.), Functional foods and nutraceuticals in metabolic and non-communicable diseases. Academic Press, Elsevier Inc. (ISBN: 978-0-12-819815-5).
2.	Rathod P.J. (2022). Practical Manual forUG Horticulture course PHT1.1 Food and Nutrtion, Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh
3.	Rathod P.J. (2022). Practical Manual for UG Agriculture course Fundamentals of plant biochemistry(Biochem2.1), Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh
4.	Richa Mishra, Abhishek D. Tripathi, Ram B. Singh, Douglas W. Wilson and Rukam S. Tomar (2022). Estimates of functional food and nutraceutical availability in the world, with reference to food peroxidation and food safety. In: Ram B. Singh, Shaw Watanabe, and Adrian Isaza (eds.), Functional foods and nutraceuticals in metabolic and non-communicable diseases. Academic Press, Elsevier Inc. (ISBN: 978-0-12-819815-5).
Year 2023-24
1.	Shital M. Padhiyar, Jasminkumar Kheni, Shraddha B. Bhatt and Rukam Singh Tomar* (2024). Genetic Improvement of Barnyard Millet Through Advanced Biotechnological Methods. In: Sweta Mishra, Shailesh Kumar & R C Srivastava (eds), Genetic Improvement of Small Millets.Springer Nature Singapore Pte Ltd., Singapore 189721, Singapore.
2.	Riddhi H. Rajyaguru, Nataraja Maheshala, Priyanka Sharma, Hiren Bhalani and Rukam Singh Tomar* (2024) Genetic Improvement of Foxtail Millet Through Advanced Biotechnological Methods. In: Sweta Mishra, Shailesh Kumar & R C Srivastava (eds), Genetic Improvement of Small Millets. Springer Nature Singapore Pte Ltd., Singapore 189721, Singapore.
3.	Jasminkumar Kheni and Rukam S. Tomar*(2023). Nutraceutical Usages and Nutrigenomics of Castor. In: Chittaranjan Kole (Eds): Compendium of Crop Genome Designing for Nutraceuticals. Springer-nature, Berlin, Germany.
4.	Zahra Ghorbanzadeh, Rasmieh Hamid, Mohammad Reza Ghaffar, Bahador Maleknia, Rukam S. Tomar, and Feba Jacob Thoppurathu (2023) Bio-Nanotechnological Methods in Crop Production and Pest Management. In: Vishnu D. Rajput, Abhishek Singh, Tatiana Minkina, Krishan Verma and Awani Kumar Singh (eds), Nanotechnology for Sustainable Agriculture: An Innovative and Eco-Friendly Approach. CRC Press, Taylor & Francis Group, USA.
5.	Balaji Rathod, Shashikant Sharma, Khyati R. Savani, Devendra Kumar, Mansi Barot and Rukam Singh Tomar* (2023). Role of Genetic Engineering in Male Sterility for Hybrid Seed Production.
6.	Balaji Rathod, Shashikant Sharma, Devendra Kumar, Khyati R. Savani, Mansi Barot and Rukam Singh Tomar* (2023). Transcript and Protein Analysis.
7.	Zahra Ghorbanzadeh, Rasmieh Hamid, Feba Jacob, Rukam Singh Tomar (2023). Coriander transcriptome: Trends, Scope, and Utilization for Coriander Improvement. In: Handbook of Coriander (Coriandrum sativum), Taylor & Francis Group, LLC, Abingdon, England
8.	Zahra Ghorbanzadeh, Rasmieh Hamid, Feba Jacob Thoppurathu, Rukam S. Tomar and Bahador Maleknia (2023). Biotechnological Methods In: Pest Management For Sustainable Agriculture. In: Vishnu D Rajput & Abhishek Singh (eds.), Emerging Tools for Sustainable Agriculture and Food Security. Nova Science Publishers, Inc., Hauppauge, NY, 11788 USA
9.	Rathod P.J. (2023). Practical manual for Advances in Enzymology , Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh
10.	Rathod P.J. (2023). Practical manual Biotechnological approaches for vegetable crops, Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh
11.	Rathod P.J. (2023). Practical Manual for Fundamental of Plant Biochemistry, Department of Biotechnology, College of Agriculture, Junagadh Agricultural University, Junagadh

Recommendations for scientific community (in brief with title) / Patent

Year 2015-16

1. QTL Mapping and development of SCAR marker for Fusarium wilt (Fusarium oxysporum f. sp. ricini) in castor (Ricinus communis).

The scientific community involved in castor improvement are recommended to use below mentioned JAUC series of primers to transfer resistance toward fusarium wilt into the new genotype through Marker Assisted Selection (MAS) or Marker Assisted Backcrossing (MAB).

Sr. No.	Primer name	Sequence	Product Length
1	JAUC1F	CAATGTCGAGCATAGCTGCC	312
	JAUC 1R	ACAATTGGCGAAGCAAGCTG	312
2	JAUC 2F	GTCGAGCATAGCTGCCAACA	166
	JAUC 2R	ACGTTCAGCCAACAAAAGCC	166
3	JAUC 3F	TGTCGAGCATAGCTGCCAAC	853
	JAUC 3R	ATGCCACCTCCAGCATACAC	853
4	JAUC 4F	GTCAATGTCGAGCATAGCTGC	389
	JAUC 4R	GGTCCCTGATTACCAGACGC	389
5	JAUC 5F	AATGTCGAGCATAGCTGCCAA	864
	JAUC 5R	TCACTAGCAATGCCACCTCC	864

2. Sex determination of papaya (Carica papaya) through Molecular characterization.

The scientific community involved in papaya improvement are recommended to use below mentioned JAUP series of primers to determine pre-flowering stage sexuality in ‘Madubindu’ variety of papaya.

Sr. No.	Name of Primer	Primer Sequence	Product Length
1	JAUP1F	GCGTTTCGAGGAGATGGTCA	410
	JAUP 1R	ACCTAACAAACTTGGCTGGC	410
2	JAUP 2F	TTTATTTCTTTCGGCTGCGGG	782
	JAUP 2R	AGCTGCTTCTTCACGCTCAT	782
3	JAUP 3F	ACCCTCGGAAACAGGACAAG	427
	JAUP 3R	TTGGCATAACGGGTGTTGGA	427
4	JAUP 4F	CCGCTCCCTCTTTTTCTGGT	487
	JAUP 4R	ACATGCAAGAGTGTAGCGCA	487

3. QTL Mapping and development of SCAR marker for Macrophominaroot rot in castor (Ricinus communis).

The scientific community involved in castor improvement are recommended to use below mentioned JAUC series of primers to transfer resistance toward root rot into the new genotype through Marker Assisted Selection (MAS) or Marker Assisted Backcrossing (MAB).

Sr. No.	Primer	Sequence	Product Length
1	JAUC6F	TGGTATTCGGGGCAGGAATG	851
	JAUC 6R	GAAAGCCCTCTGCCATCCAT	851
2	JAUC 7F	GTGGGCATGGGTGGTATAGG	622
	JAUC 7R	CGCTCACCAAGTCCCACATA	622
3	JAUC 8F	GTCTATGGATGGCAGAGGGC	345
	JAUC 8R	TCCAGGAAGGCGAGCTATCA	345
4	JAUC 9F	GATGCCCTTGGGCTAAGCAT	157
	JAUC 9R	AGCCATTGCAATCGGTCTGA	157
5	JAUC 10F	GGGGCAGGAATGAGGACAAG	97
	JAUC 10R	CCTATACCACCCATGCCCAC	97

Year 2016-17

1. Biochemical and molecular characterization of phosphate solubilizing bacteria from different soil rhizosphere.

It is informed to scientific community that among 17 PSBs, isolate derived from chickpea rhizosphere exhibited highest phosphate solubilizing index followed by isolates from pigeonpea rhizosphere and poultry farms. The best PSBs were confirmed as Pseudomonas putida and Pseudomonas fulva.

Year 2017-18

1. Development of cultivar specific markers for the hybrids released by JAU in pearl millet.

The scientific community involved in pearl millet improvement are recommended to use below mentioned JAUB series of primers for the identification of hybrids.

Primer Name	Primer Sequence	Product Length	Hybrid
JAUB5F	CTGCTTCTTCTCGTAAT	941	GHB 538
JAUB5R	TTCGCCAGGAGGGCGT
JAUB7F	ATCGCTACGTCTACGATG	527	GHB 558
JAUB7R	TCTCCGATTAGGTCGTTG
JAUB17F	TACCTTTGTGTTGATGGTTT	415	GHB 577
JAUB17R	CTACTCTTGTTCCTCCTCT
JAUB10F	CAACATACCTCTCGTACGGT	1020	GHB 719
JAUB10R	TTTTCGGATAGTTCAAACAGT
JAUB1F	TAGCTGGGTAGAGGCTGACT	249	GHB 526
JAUB1R	GCCTGTTGACAGTCCGTAGA
JAUB22F	CGCAGTGGATTATCCCTCTC	354	GHB 732
JAUB22R	GGATGACCCTCGAAACCATA
JAUB24F	GGCATCTCGTTGTACCTCGT	339	GHB 744
JAUB24R	AACAGCATCAGAGCGGACTT
JAUB27F	CTTGTGCCTTGGAGCTGTTT	550	GHB 757
JAUB27R	GTGGCTGTTGTCATGAATGC
JAUB30F	TTAGCATTTTGCGCTTTGTG	250	GHB 905
JAUB30R	GCATGAATCAGCCCATACAA
JAUB15F	TGTGTTCTAATGTGCTATGTA	330	GHB 941
JAUB15R	CACTAAGCTTCATGACGTGAT

2. Development of cultivar specific markers for the varieties released by JAU in Groundnut

The scientific community involved in Groundnut improvement are recommended to use below mentioned JAUG series of primers for the identification of groundnut varieties.

Primer Name	Primer Sequence	Product Length	Variety
JAUG12F	CACCAAGTGGGAGAGGAAAA	352	GJG 22
JAUG12R	CCAACACTACCCCATTCTGG
JAUG13F	GTGGCCAAAGATTTCACACA	1201	GJG 17
JAUG13R	GTCCGATGGCAGCTCTATGT
JAUG1F	GTCGATGAGACGGCTAGTGG	348	GJG 31
JAUG1R	TCGTGACGAGGGTGATCTCT
JAUG17F	TCGGGATGTGTTTATGTTGC	386	GJG 9
JAUG17R	GGAGTTCGCACATTGTGTTG
JAUG20F	GCTGGTTAGTTGTGCGGATT	409	GJG HPS 1
JAUG20R	CTCCCCCTTATTGGATAGGC
JAUG22F	CGAGTATCCCGAACCCTACA	265	GJG 20
JAUG22R	AAAAGGGTTGGTTTCGCTTT
JAUG4F	CGCACGCATGCCCTAAATAC	355	GG 5
JAUG4R	TTGGGTGCGGATGAGAAAGG
JAUG26F	TGAGGATTTGCCGTTTCTTT	405	GJG 7
JAUG26R	CCCGTCCCCAAATGATAGAT
JAUG8F	AAACCGCTGTGTCTCTCTGC	329	GG 11
JAUG8R	GCCTGTTGACAGTCCGTAGA

3. Biochemical and molecular characterization of brinjal varieties and promising genotypes

It is recommended to the scientific community that the most diverse varieties were found to be GOB-1 and JBGR-1 compared to the other promising genotypes and varieties based biochemical, nutritional analysis. The diverse GOB-1 contained higher protein, total soluble solids, soluble sugars, phenols, ascorbic acid, PPO activity and flavanoid content and lower in glycoalkaloids and acidity. The clustering pattern on the basis of molecular analysis (SSR) depicting diverse varieties GOB-1 and GJB-3 out grouped from other genotypes with 48 % similarity.

4. Genome sequencing of pathogenic Macrophomina phaseolina isolated fromcastor.

It is recommended to the scientific community involved in castor improvement that the sequencing of plant pathogenic fungi Macrophomina phaseolina showed the size of genome is 98.6 Mb. The draft genome having 3061 contings, 30756 genes, 183303 exon, 28096 SSR and 13947 repeat region present in the genome. In genome 24.30 % of genes involve in molecular function, 34.27% of genes involve in cellular component and 41.43% of genes involve in biological process. pathogenicity related genes identified in this study have high relevance in future fungicide designing and following primers will be used for the specific identification of pathogenic fungi Macrophomina phaseolina.

Name	Primer 3'-5'	Product length	GC%	Tm
JAUMPF1	GGAGAGTTTGCGTCAAGTCC	202	55	59.85
JAUMPR1	ACTGTCGGAGAAACCGAAGA	202	50	59.84
JAUMPF2	GCGAACTCAATCCCAACATC	226	50	60.47
JAUMPR2	TCGACCATGAGGGTTTTCTC	226	50	60.05
JAUMPF3	CGCACTAATAATCGGCCCTA	193	50	60.07
JAUMPR3	GTAAAAGTGCGTTGGCGTTT	193	45	60.17

5. In situdetection of potassium status in cotton plants

It is recommended to the scientific community that silver and carbon nanoparticles based nano-biosensor developed for detection of potassium deficiency directly from the leaf sap of plants. The nano-biosensor works on the basis of ion-selective mechanism to detect potassium ion in the range of 10 mM to 120 mM. The deficiency of potassium below threshold line of 40 mM from sap with the sensor display indicating the voltage output below (-ve) 15 mV will be signaled. The onetime cost of the developed nano-biosensor is about Rs. 2500-3000 and worked to detect potassium deficiency level at any growth stage of cotton crop.

Year 2018-19

1. Draft genome sequencing and analysis of fungal phytopathogen Sclerotium rolfsii to reveal insight into its genetic structure.

It is recommended to the scientific community involved in Groundnut that the sequencing of plant pathogenic fungi Sclerotium rolfsii showed the size of genome is 73 Mb. The draft genome having 8919 contings, 16830 genes and11171 SSR present in the genome. In genome 3507 and 261 genes involve in Transporter and catalytic function respectively , 1571 genes involve in cellular component and 709 of genes involve in biological process. pathogenicity related genes identified in this study have high relevance in future fungicide designing and following primers will be used for the specific identification of pathogenic fungi Sclerotium rolfsii.

Name	Primer 3'-5'	Product length	GC%	Tm
JAUSRF1	GAAGAGTTTGCGTCGAGTCC	250	55	59.85
JAUSRR1	GCTGTCAGAGAAACCGAAGA	250	50	59.84
JAUSRF2	ACGAACTCGATCCCAGCATC	170	50	60.47
JAUSRR2	TCGATTATGAGGGTTTCCTC	170	50	60.05
JAUSRF3	CGGACTAATAATCGACCCTA	230	50	60.07
JAUSRR3	ATAAAGGTGCGTTGACGTTT	230	45	60.17

Year 2019-20

1. Qualitative and nutritional evaluation of promising genotypes of groundnut.

The scientific communities involved in groundnut improvement are recommended to use below mentioned groundnut genotypes for the qualitativeand nutritional improvement of groundnut crop.

	Trait for improvement		Name of genotype
1	Total Carbohydrate	:	GG-16, KDG-123, GG-4, RG-578
2	Total Soluble Sugar	:	TG-51, ICGV-00440, JL-501
3	True Protein	:	RG-510, TG-51, TG-37
4	Total Oil	:	TLG-45, J SSP-35, ICGV-86156, GG-20
5	Iron	:	JL-501, ICGV-91114, AG-2006-6
6	Calcium	:	GJG-9, ICGV-02266, TPG-41, GJG-17
7	Oleic Acid	:	ICGV-15055, ICGV-15050, ICGV-15035
8	O/L ratio	:	ICGV-15035, ICGV-15033, Sunoleic

2. Phytochemical, antioxidant and antidiabetic characterizations of custard apple (Annona squamosa L.) genotypes

It is informed to the scientific community that fruit pulp of custard apple genotypes DS-1, Aml-10 and Aml-6 acquired higher antidiabetic potential (as α amylase inhibition) and antioxidant activity (as % DPPH free radical scavenging). The ascorbic acids and phenols contributed positively for both antidiabetic and antioxidant potentials in fruit pulp of custard apple. Phytochemicals analysis illustrated that terpenoids and flavonoids present in fruit pulp are positively correlated with antioxidant activity and that of alkaloids contributed significantly positive correlation for antidiabetic potential.

Year 2020-21

1. Studies on Phytochemicals And Metabolomics Profiling of Seaweeds

The seaweed resources viz., Green, Red and Brown seaweeds analyzed through MS/MS based platform showed presence of 375 unique compounds. These seaweeds were found to contain important oil content, vitamin D3 and many
bioactive compounds that can be used as nutraceutical products. In case of ω-3 polyunsaturated fatty acids, eicosapentaenoic acid (EPA) was found in seaweed species, viz., Sarconema filiforme(5.02%) and Spatoglossum asperum(4.04%).
Vitamin D-3 was found in Caulerpa Lenthilifolia(16.7%), Caulerpa sertulorioides(8.5%), Ulva fasciata(10.7%), Halimeda tuna(12.7%), Hydroclatharus clathratus(18.9%), Halymenia venusata(6.5%), H. porphyraeformis(20.6%), Dictyopteris marginatum, Gelidiopsisrepens(18.2%) and Heterosiphonia muelleri(26.1%). Some species of seaweeds viz, Dictyopterisdelicatula(2.68%), Heterosiphonia muelleri(0.24%), Dictyopterismarginatum (stoecospermum) (4.07%), Spatoglossum asperum(8.1%), Padina gymnospora (4.86%), Caulerpa lenthilifolia(0.96%) contained docosahexaenoic acid (DHA). These compounds are notfound in plants.

2. Transcriptome and Proteomic Characterization for Identification of Candidate
Genes Responsible for Pistillate Inflorescence and Its Reversion in Castor The scientific community involved in Castor improvement are recommended to use the set of 14 primers as mentioned below to distinguish the pistillate and monoecious plants in castor. They are also advised to use the castor database developed (http://webtom.cabgrid.res.in/castdb/) for the identification of gene of interest and selection of SSRs and their primers to be used under Marker Assisted Selection and molecular breeding.

Sr. No	Name of the gene Gene	Forward primer	Reverse Primer	Gene Function
1	Dynamin-2A	GCTAAGCAAGGGTTCGTCAG	CTGGCAGGTCGATCAATTTT	Response to hormone stimulus
2	Auxin response factor	CACACATGGTGG G TT CTCAG	TGAGTTGGTGGTTGCA TTGT	Organ development; and post-embryonic development
3	ATP-binding protein	CATTGGACAGGT CCT CCACT	AAGCAAGGTGAAGCA AGGAA	Regulation of ARF protein signal transduction
4	Spermidine synthase	GGTGCTGCATTTC TC TCCTC	TGCCCTGGAATAAATC TTGC	Polyamine biosynthetic process
5	Xaa-pro amino peptidase	GGATGGAAGCTTT GG CATAA	GCCCTTCTCACCAAAA TTGA	Auxin transport
6	Conserved hypothetical protein	TCGAATGAAGAG GCC ATTCT	GTGAGAAGGGCAAAA GCAAG	Abscisic acid metabolic process
7	MADS box protein	AAAGGTTGGCCTG A GGAGTT	GTCACTTGCCTGTTGC TTGA	Transcription, DNA-dependent
8	RNA polymerase sigma factor rpoD1	GATCTTCAGGCAA G CACTCC	ATATCCTCCCCTTGGT C CAC	DNA-dependent transcription, initiation
9	Protein with unknown function	TTGTCAAGGGCCA G TTCTTT	TTGACCTGCTGTGTCC C ATA	Guanylribonucleoti de binding
10	Arginine/serine- rich splicing factor	CGGAAGCTTGATG A CACTGA	GGCTTCTACTTCGGCT C CTT	Sex differentiation
11	Acid phosphatase	TCCTGTAACCGTT CC TTTCG	TGTTCAGGCTCGAAAC CTCT	Phosphatase activity
12	DNA replication helicase dna2	AGGCTGTGAATA ACC CAACG	CCCAATATCTTCGCCT T GAA	DNA metabolic process
13	Eukaryotic translation initiation factor2c	CACGACTTTTTCC CG TTGAT	GAACTCCCTCTGGTGG CATA	Translation
14	s-adenosyl- methyltransferase	TCTCCGTTCTTTC GT CGATT	GGGTCAACATCCATTC CAAC	rRNA methylation

3. Genome Sequencing of Cumin (CuminumcyminumL.) to Reveal Insight of its Genomic Architecture

The scientific community involved in Cumin improvement are recommended to use genomic information generated (https://drive.google.com/file/d/ 1ukln R77l YWJcR Ip8m40lLpm OP_ujqJz/view ?usp=sharing)for cumin in Marker Assisted Selection for the improvement of cumin. They are also advised to use the genes identified as mentioned below and SSRs identified in Marker Assisted Selection.

Sr. No.	Character	Number of genes	Gene identified
1	Flavonoid	21	U78D2, C75A2, 75A4, C75B3, C93C F3PH, FAOMT, FL3H3, MOMT, SOMT SOT5, UFOG, UFOG1, UFOG2, UFOG UFOG4, UFOG5, UFOG6, FOG7, UGF and Y1103
2	Chalcone synthase	9	6DCS, CHS1, CHS2, CHSA, CHSB, CHS CHSL1, CHSY, PKS5
3	Chalconeisomerase	4	CFI, CFI1, CFI2B, CFI3
4	Flavanone synthase	3	C93C1, FNSI, C93B1
5	Terpenoid synthase	15	BAMS, GBIS1, GBIS2, HUMS, TPS TPS05, TPS07, TPS08, TPS09, TPS TPS18, TPS22, TPS26, TPS29, TPS30
6	Disease resistance	89	ADR2, CDR1, CHS1, CSA1, DF230, DR206, DRL12, DRL13, DRL14, DRL15, DRL16,DRL17, DRL18, DRL19, DRL2, DRL20,DRL21, DRL23, DRL24, DRL25, DRL26,DRL27, DRL28, DRL29, DRL3, DRL30,DRL31, DRL32, DRL33, DRL34, DRL36,DRL37, DRL38, DRL39, DRL4, DRL40,DRL41, DRL42, DRL43, DRL45, DRL5,DRL7, DRL8, DRL9, DSC1, DSC2, EDR1,EDR2, EDR2L, EDR4, LAZ5, LOV1A,NDR1, R13L1, R13L2, R13L3, R13L4,RFL1, RGA1, RGA2, RGA3, RGA4,RLM1B, RLM3, RP8HA, RP8L2, RP8L3,RP8L4, RPM1, RPP1, RPP13, RPP4, RPP5,RPP8, RPS2, RPS4C, RPS4L, RPS4W,RPS5, RPS6C, RPS6R, RPS6R, SUMM2,TAO1, WR52C, WR52N, WR52R, WR52W,Y4117
7	Antifungal	4	DEF1, DEF15, DEF2, DEF4
8	Early flowering	13	ASHH2, EFM, ELF3, ELF6, HD16N, PA PIE1, REF6, RUP1, RUP2, SKIP, SWC VIP6
9	Aromatic	11	5MAT, ANTA, AVT3A, AVT3B, AVT3 DDC, ISS1, PGL1, PGL2, PGL3, SOT16
10	Drought	8	AL7A1, DIS1, ERG14, HDG11, LSM5, SAD2, SDIR1, SSP1A
11	Nematodes	2	ELF3, HSPR2

4. Transcriptome Analysis in Coriander for Identification of Candidate Genes Against Stem Gall Disease

The scientific community involved in Coriander improvement is recommended to use the following set of 7 primers in the process of marker assisted selection for the identification of disease defence genes in coriander genotypes

Sr. No	GeneName	ForwardPrimer	ReversePrimer	Function
1.	RL31	GCCAAACCAAAAG GTGAGAA	CGGATACCCTTA GCCCAGAT	Jasmonic acid Mediated signalingpathway
2.	A0A2Z5D8 54	CCACCGTTTCCAAT GCTAGT	GGAATCTCTCGG GCCTAAAC	Metal ion binding
3.	A0A166CJ74	ATTGGCTGAGCTTT GGATTG	GGCTTGATGCTC CATTGTTT	Regulation of Transcription DNA-template
4.	A0A166CJ74	CACGCATTTCTCCT CCTGAT	TCAGAGGGGGT TTTCTGATG	DNA-template
5.	Y1934	ACTCGGTGTCACGG TTTTTC	CAAAAGCCGAG ATTGTGGAT	Molecular function DNA- binding
6.	TGA10	CCCTGTTGGGAAAC TTCGTA	GCTGCAAAGGT CCAGCTATC	Nitrogen- activated protein kinasebinding
7.	A0A164XUZ0	GAGTTGGAGTTCAG GGAGGA	GATGAGCGGGA TATCTGGAA	Affects Fungal Development and Pathogenicityof Fusarium graminearum

5. Elemental, Nutritional and Microbiological Analysis of Panchagavya (Ancient Liquid Organic)

The Scientific community involved in Panchagavya research or microbial research are recommended to use 19th day old Panchagavya to study maximum microbial diversity.The higher proportion of α-proteo bacteria was observed in 19th day of Panchagavya preparation while 21st Day Panchagavya formulation was found to be dominated by Firmibacteria, β-proteobacteriaor Actinobacteria. The presence of unknown/novel microbeswere higher in 21st day old Panchagavya on the basis of results of Metagenomic analysis.

a)Panchagavya contained dominant bacteria of nitrogenfixing, phosphate solubilizers and potashmobilizers. Moreover, its how edantagonism towards plant pathogenic fungi like Helminthosporium(47%), A.flavus(45%), A.niger(35%) and Sclerotiumrolfsii(40%) invitro. Elemental composition of Panchagavya showed higher concentration of Fe(158.94ppm), Ca (2789.99ppm), Mg(1553.76 ppm) and Mo(25.50ppm). It also contained N-Methyl-2-pyrrolidinone used as in secticide, herbicideandfungicide. Phenylacetaldehyde is a second major compound found which has very important antibiotic compound.

b) Bijamrut elemental analysis revealed that it contains Cu (4.19 ppm), Fe (111.16ppm), Mn(1.56ppm), Zn(2.40), Ca(1211.63ppm) and Mg(1084.65 ppm) which can provide immunity against various diseases and improve seed germination. It also contained important compound5(6)-EpETrE-EA which has antagonistactivity against pathogenicmicrobes. 17beta-Nitro-5alpha-androstane is theaza-steroid which enhances the germination of plant seed.

c) Liquid organic preparation of Jivamrut has bacteria, fungi, actinomycetes, N- fixers and P-solubilizers and K-mobilizers. Jivamrut in hibited Helminthosporium (40%), A.flavus(30%), A.niger(25%) and Sclerotiumrolfsii(35%),Fusarium oxysporum(35%). Jivamrut contains high concentration of Fe (115.09ppm), Ca (1575.78 ppm), Mg (621.57ppm) and Co (88.90ppm). LC-QToF analysis showed Pyropheophorbide is anantioxidant found in Jivamrut.

d) Amrutpani is a good source of micronutrient which includes high concentration of Fe(208.44ppm), Ca(2276.73ppm), Mg (1119.15ppm) and Ti (73.05ppm). LC-QT oF analysis revealed that AdouetineZ isaninsecticidalcyclic peptide and (5alpha,8beta,9beta)-5,9-Epoxy-3,6-megastigmadien-8-olisan antioxidant compound found in Amrutpani.

e) Sanjivak has antagonist activity and micro nutrient content with important compound like Methyl jasmonate.

6. Biochemical and Molecular Evaluation of A1 and A2 Casein Protein of Milk in Holstein Friesian Cow and Indigenous Gir Cow

The scientific community involved in cow improvement is recommended to use DNA markers to detect or distinguish A1A2 and A2A2 genotypic frequency among the Gir Bulls and Cows using below mentioned marker.

1	A1 Forward	5’ CTTCCCTGGGCCCATCCA 3’
1	A1 Reverse	5’ AGACTGGAGCAGAGGCAGAG 3’
2	A2 Forward	5’ CTTCCCTGGGCCCATCCC 3’
2	A2 Reverse	5’ AGACTGGAGCAGAGGCAGAG 3’

7. Studies on Phytochemicals And Metabolomics Profiling of Seaweeds

The seaweed resources viz., Green, Red and Brown seaweeds analyzed through Ms/Ms based platform showed presence of 375 unique compounds. These seaweeds were found to contain important oil content, vitamin D3 and many bioactive compounds that can be used as nutraceutical products . In case of ω-3 polyunsaturated fatty acids, eicosapentaenoic acid (EPA) was found in seaweed species, viz., Sarconema filiforme (5.02%) and Spatoglossum asperum(4.04%). Vitamin D-3 was found in Caulerpa Lenthilifolia (16.7%), Caulerpa sertulorioides (8.5%), Ulva fasciata (10.7%) , Halimeda tuna (12.7%) , Hydroclatharus clathratus (18.9%), Halymenia venusata (6.5%), H. porphyraeformis (20.6%), Dictyopteris marginatum, Gelidiopsisrepens (18.2%) and Heterosiphonia muelleri (26.1%). Some species of seaweeds viz, Dictyopterisdelicatula (2.68%), Heterosiphonia muelleri (0.24%), Dictyopterismarginatum (stoecospermum) (4.07%), Spatoglossum asperum (8.1%), Padina gymnospora(4.86%), Caulerpa lenthilifolia (0.96%)contained docosahexaenoic acid (DHA). These compounds are not found in plants.

Year 2021-22

1. BCJ-62: Development and characterization of polymer based nanofertilizers and their response to wheat

Chitosan nanoparticles (CS-NPs) were synthesized and examined greater than 40 mV zeta potential indicating good stability. The urea, tricalcium phosphate and muriate of potash were used as sources for incorporation of N, P and K elements individually onto the CS-NPs and the elevation of size of the nanofertilizers, without aggregation of nanoparticles, were observed. Scanning electron micrograph illustrated spherical shape of the CS-NPs and gave the idea about the morphology of incorporated NPK nanofertilizers. The FTIR study indicated that there is a electrostatic interaction occurs between the charges of CS-NPs and the N P K elements, resulted to stretching of spectra (peak) at specific wavelength confirming the incorporation of N P and K elements on to the CS-NPs. The application of 5% NPK nanofertilizers (10 time less) on wheat suggested higher nutritional seed quality and maintained yield equivalent to chemical fertilizers. The cost-effective NPK-nanofertilizers thus developed may save the forex (subsidy) about 38.22%. It has better controlled-release system in a liquid formulation to enhance nutrient use efficiency and sustained crop growth.

2. Isolation and identification of entomopathogenic microorganisms from the soils of Junagadh district.

The Scientific communities involved in microbial and entomological research are recommended to use native identified entomopathogenic microbes including 213 Pseudomonas putida (MK415028.1), P. monteilii (KT881478.1), P. knackmussii (KY324901.1), P. fulva (KC293832.1), Bacillus subtilis (MH141058.1), B. thuringiensis (KY003094.1), B. clausii (AB251924.1), Enterobacter asburiae (MK 467572.1), E. cloacae (JX514409.1), Beauveria bassiana (KC753382.1), Metarhizium anisopliae (KJ573520.1) and Verticillium lecanii (AJ292383.1) for the production of biofertilizer and biocontrol agent as they suppressed Helicoverpa armigera, and have PGPR activity

3. Isolation and identification salt tolerant strains of beneficial microorganisms from the coastal soils of Saurashtra region.

Native halophilic bacterial strains isolated from agricultural soils of coastal regions of Saurashtra have potential for application in both industries and agriculture. The promising performance of these isolates in terms of plant growth promoting characteristics such as nitrogen fixing capacity, solubilization of phosphate and potash, production of IAA, siderophore along with production of biochemically important enzymes and bioactive compounds such as chitinase, cellulase, protease, carotene, ectoine, glycine betaine was observed. Halophilic bacterial isolates were Halomonas pacifica strain_JAU_7B (MK955347), H. pacifica strain_JAU_20A (MK575078), H. pacifica strain_JAU_22A (MK042491), H. pacifica strain_JAU_22C (MK043087), H. pacifica strain_JAU_25A (MK116946), H. pacifica strain_JAU_29A (MK114047), H. pacifica strain_JAU_36A(MK114047), H. pacifica strain_JAU_36B (MK114047), H. stenophila strain_JAU_37A (MK961217), Oceanobacillus aidingensis strain_JAU_39B (MK148253), H. pacifica strain_JAU_40B (MK114047), Bacillus haynesii strain_JAU_41A (MK157609), B. licheniformis strain_JAU_43A (MK118996), B. haynesii strain_JAU_43B (MK157608) and B. haynesii strain_JAU_45A (MK157609) which confirmed through molecular characterization by 16srRNA

4. Biochemical appraisal of enzymatic activities from soils of permanent plot experiment at JAU, Junagadh

The soil enzyme activity studied viz., urease, acid phosphatase, alkaline phosphatase, −Galactosidase and nitrate reductase, from the plot having different fertilizer applications, remains higher during the mid-season and found to be lower before sowing and after harvest of the crop. Minimum variation of enzyme activity was observed in a plot of only FYM treatment (25 tons/ha). The activity of urease, B−Galactosidase and B−gluosidase as well as acid phosphatase and alkaline phosphatase was enhanced by balance fertilizer application (100 % NPK (25:50:50) as per soil test as well as 25 tons/ha FYM application. The pod yield of groundnut was remained highly positively correlated with urease, acid phosphatase and alkaline phosphatase enzyme activity.

5. Diversity analysis of fresh water diatoms through SEM-EDX from surface microalgae of water bodies of Junagadh region

The scientific community involved in diatom study of fresh water in context to climate change and environment are recommended to use cataloguing of fresh water diatoms collection images from water bodies in and around JAU, Junagadh. Total 46 species of diatoms were identified from water bodies of Junagadh, out of which eleven genera viz., Cyclotella, Melosira, Navicula, Achnanthes, Amphora, Synedra, Nitzschia, Gomphonema, Hantzschia, Pinnularia and Fragillaria were predominant.The sizeable variation among the elements presents on freshwater algae through SEM EDAX showed the presence of all macro elements except phosphorus and nitrogen. All species of diatoms had higher amount of diversity indices including Shannon-Wiener diversity index (3.57) and Berger Parker Dominance (30.57). Morphometric analysis showed wider variability in location and species wise according to length (7.049 μm to 43.08 μm) and width (2.53 μm to 23.44 μm) as well

as diversity indices too. Willington dam site showed maximum spp. variation of diatoms than the other location.

Year 2022-23

1. Development of biochemical and molecular markers for heat tolerance in chickpea

The chickpea genotype namely ICC-4958 was identified highly tolerant when exposed to 42/37 oC temperature at germination stage. This genotype had high antioxidant activity, ascorbic acid, glutathione, super oxide dismutase, ascorbate peroxidase, glutathione reductase along with Quinone oxidoreductase, glutaredoxine and heat shock protein 70. SSR markers namely Cam1536, TA27, TR 58 could also reveal this genotype different at DNA level. Hence, this genotype can be exploited in breeding to develop heat tolerant lines/varieties of chickpea.

2. Diversity analysis of marine diatoms through SEM-EDX from surface microalgae of saurashtra coastal belt

The scientific community working on diatoms of coastal belt of Saurashtra are recommended to use diatoms diversity analysis done through Scanning electron microscopy as ready references. The diatom analysis of marine samples from three locations (Okha,Veraval and Aadri) identified fifty diatom species and most of them are pennate types. The Cocconeis spp, Grammatophora spp, Fragilaria sp, Nitzschia sp, Navicula sp., Achnanthes spp and Licmophora were found dominant diatoms on the surface of microalgae. Again, diatom abundance of Cocconeis scutellum was reported higher than 52% of total diatom considering three locations. The energy dispersive X-ray spectroscopy (EDS) graph prepared for individual species of diatoms from SEM images observed that the frustules of the diatoms wereother than Si. It has many elements at various sites attached to them. The catalogue of diatoms and alfa-diversity index revealed many diverse rich populations in coastal belt of Saurashtra

3. Biochemical analysis based lipid indices of edible, non edible and medicinal herbs oils

Scientific community involved in lipid indices of edible oil research is recommended to use the sets of following biochemical based fatty acids calculation for the quality of oils and their lipid indices.

Edible oils	DR	ODR	LDR	MUFA	PUFA	SFA	DU	UI	AI	TI
GG-20	0.009	0.247	0.001	63.72	20.64	15.64	105.0	590.5	0.14	10.32
GG-21	0.008	0.185	0.003	69.62	15.67	14.71	101.0	597.0	0.13	9.18
GG-3	0.009	0.451	0.001	44.47	35.93	19.6	116.3	562.8	0.19	13.30
Coconutseedoil	0.007	0.396	0.011	11.43	7.05	81.52	25.5	129.4	20.73	34.60
Cornoil	0.012	0.563	0.005	33.24	41.43	25.33	116.1	522.7	0.67	23.17
Cottonseedoil	0.003	0.645	0.035	26.01	40.88	33.11	107.8	468.2	2.19	28.78
Soybean	0.022	0.612	0.025	23.5	53.88	22.62	131.3	541.7	0.36	14.30
Sunflower	0.007	0.630	0.019	30.71	47.09	22.2	124.9	544.6	4.32	17.60
Brownmustardseed	0.181	0.647	0.439	57.51	30.26	12.23	118.0	614.4	0.06	40.74
Whitesesame	0.001	0.558	0.011	39.17	48.19	12.64	135.6	611.5	0.09	10.00
Blacksesame	0.001	0.574	0.007	38.07	50.47	11.46	139.0	619.8	0.08	8.34

DR= Desaturation ratio; ODR= Oleic desaturation ratio; LDR= Linoleic desaturation ratio; MUFA= Monounsaturated fatty acid; PUFA= Polyunsaturated fatty acid; SFA = Saturated fatty acid; DU= Degree of unsaturation; UI= Index of unsaturation; AI= Atherogenic index; TI= Thrombogenic index

4. Biochemical analysis based lipid indices of edible, non edible and medicinal herbs oils

Scientific community involved in the essential oil research of the following crops are recommended to use marker bioactive compounds detected through GC MS platform

Name of crops	Important Marker Bioactive compounds
Blackpepper (PipernigrumL.)	Piperine(α.-Phellandrene,4.64%) cis-sabinene(23.21%) Caryophyllene(13.58%) Caryophylleneoxide(0.33%) 1,4-Cyclohexadiene, 1-methyl-4-(1-methylethyl) (20.84%)
Volatileoil of Cardamom	α-Terpinyl acetate(37.05%) Eucalyptol (25.79%) Sabinen (3.41%)
Volatileoil of Cinnamom	Cinnamaldehyde, (E) (77.55%) Copaene(2.98%)
Volatileoil from leavesof cinnamom	Phenol,2-methoxy-3-(2-propenyl)(79.17%)., Spathulenol(3.26%) gamma.-Elemene(3.66%)., Caryophyllene(1.24%)
Volatileoil of cloves	Caryophyllene(37.5%)and Phenol,2-methoxy-3-(2-propenyl)-(44.04%)
Volatileoil of corianderleaves	LINALOOL (63.23%),2,6-Octadien-1-ol, 3,7- dimethyl-, acetate(7.78%).,1,6-Octadien-3-ol, 3,7- dimethyl(2.64%).,(1R)-2,6,6- Trimethylbicyclo[3.1.1]hept-2-ene(2.59%)
Volatileoilof cumin seeds	Beta.-Pinene(19.09%) Benzene, 1-methyl-4-(1-methylethyl)(12.4%) 1,4-Cyclohexadiene,1-methyl-4-(1-methylethyl) (10.69%) Benzaldehyde, 4-(1-methylethyl)(26.8%) TERPIN-7-AL <GAMMA-> DB5-1106 (12.36%)
Volatileoil of curryleaves	Bicyclo[7.2.0]undec-4-ene, 4,11,11-trimethyl-8- methylene-, [1R-(1R@,4Z,9S@)](29.28%) Caryophyllene(4.44%),.alpha.-Caryophyllene(4.88%) Azulene, 1,2,3,3a,4,5,6,7-octahydro-1,4-dimethyl-7-(1- methylethenyl)-(21.24%) [1R-.alpha.,3a.beta.,4.alpha.,7.beta.)]-Caryophyllene oxide (4.05%).
Volatileoil ofDill seed	Tetrahydro carvone (19.82%) trans-dihydrocarvone(14.53%) cis-Carvylacetate (25.7%) Eugenol(0.01%) And Apiol(Abotiondrug)(17.59%)
Volatile oil ofDry ginger	CURCUMENE (16.56%) Zingiberene(21.03%); FARNESENE <(E,E)-ALPHA(15.26%) beta-Sesquiphellandrene (7.61%) VALERIANOL (5.91%)
Volatileoil of fennel seed	Fenchone(8.93%) Anisole, p-allyl(5.29%) (Estragole) cis-Anethol (68.56%)
VolatileofGarlic oil	1,3-Dithiane(6.7%) Dimethyltrisulfide(7.43%) Diallyl disulphide(17.72%) Hydroperoxide, 1,4-dioxan-2-yl (26.34%) Trisulfide, di-2-propenyl (31.49%)
Volatileoil ofholy basil	1,6-Octadien-3-ol, 3,7-dimethyl (18.47%)/(Linalool) METHYLCINNIMATE(8.48%) and METHYL CINNIMATE<(E)-(45.94%)
Volatileoil ofmint leaves	Limonene(5%) 2-Cyclohexen-1-ol, 2-methyl-5-(1-methylethenyl)-, trans-(35.63%) 2-Cyclohexen-1-one, 2-methyl-5-(1-methylethenyl) (31.59%) trans-Carveyl acetate(5.19%)
Volatileoil of nutmeg	1R)-2,6,6-Trimethylbicyclo[3.1.1]hept-2-ene/ (α-Pinene-14.64%) Bicyclo[3.1.0]hexane, 4-methylene-1-(1-methylethyl)- ( cis-sabinene-18.5%) Cyclohexene, 1-methyl-4-(1-methylethenyl)-, (S)-( Limonene-5.84%) 1,4-Cyclohexadiene, 1-methyl-4-(1-methylethyl)-( α- Terpinene-5.13%) 3-Cyclohexen-1-ol, 4-methyl-1-(1- methylethyl)-( (R)-(-)-; (-)-Terpinen-4-ol-8.05%) Benzene, 1,2-(methylenedioxy)-4-propenyl-, (E)-( (β- Isosafrole-5.4%)
Volatileoil of nutmegmace	α-Pinene-(15.97%);. cis-sabinene-(17.66%);α- Terpinene-(6.23%), L-4-terpineol-(9.11%)
Turmericoil &Oleoresin	Caryophyllene(6.74 %and 0.29,% ) ZINGIBERENE(18.86%and 4.59%) Benzene,1-(1,5-dimethyl-4-hexenyl)-4-methyl(9.49% and 0.45%) SESQUIPHELLANDRENE <BETA(14.25% and 1.17% ) Tumerone(23.26% and17.39%) Ar-tumerone(25.15% and8.93%)

Dr PJ.Rathod is the one of the inventor in Patent Granted on A PROCESS OF ENZYMATIC PRE-TREATMENT ON VARIETIES OF PIGEON PEA which was filled in 29/01/2020 and Granted on 21/12/2023. Application number: 202021004030

On-Going Research Schemes/Projects

Sr. No.	Title and BH	Funding agency	Principal Investigator	Period		Sanctioned Amount (Rs. In lakh)
Sr. No.	Title and BH	Funding agency	Principal Investigator	From	To	Sanctioned Amount (Rs. In lakh)
1.	Establishment of Department of Biotechnology at College of Agriculture, Junagadh. (12401)	Gov. of Gujarat	Professor & Head	2008-09	Conti..	248.95
2.	Improvement of Agriculture production through Nanotechnology Inventions (12402)	Gov. of Gujarat	Professor & Head	2008-09	Conti..	73.65
3.	Research in Bio-Technology at Junagadh (12044-1)	Gov. of Gujarat	Professor & Head	1994-95	Conti..	13.45
4.	Molecular mapping of important traits and their transfer through marker assisted selection (MAS) in groundnut and cotton (12029)	Gov. of Gujarat	Professor & Head	2014-15	Conti..	56.30

Research experiments conducted (2019-20)

Sr. No.	Title
1.	Studies on phytochemicals and metabolomics profiling of seaweeds
2.	Elemental, nutritional and microbiological analysis of panchagavya (ancient liquid organic)
3.	Biochemical appraisal of enzymatic activities from soils of LTFE at JAU, Junagadh.
4.	Biochemical and molecular evaluation of A1 and A2 casein protein of milk in holstein friesian cow and indigenous Gir cow
5.	Comparative appraisal of cow (Gir) and buffalo (Jaffarabadi) urine for anticancerous properties through biochemical and cytotoxic characterization
6.	Isolation and identification of entomopathogenic microorganisms from the soils of Saurashtra region
7.	Isolation and identification salt tolerant strains of beneficial microorganisms from the coastal soils of Saurashtra region.
8.	Development and characterization of polymer based nanofertilizers and their response to wheat
9.	Soil and water appraisal of organic farms in Saurashtra region
10.	Development of biochemical and molecular markers for heat tolerance in chickpea
11.	Biochemical analysis based lipid indices of edible, non edible and medicinal herbs oils.
12.	Diversity analysis of marine diatoms through sem-edx from surface microalgae of saurashtra coastle belt.
13.	Diversity analysis of fresh water diatoms through sem-edx from surface microalgae of water bodies of Junagadh region.
14.	Genome sequencing of cumin (Cuminum cyminum) to reveal insight of its genomic architecture
15.	Transcriptome analysis in coriander for identification of candidate genes against stem gall disease
16.	Transcriptome and Proteomic characterization for identification of candidate genes responsible for pistillate inflorescence and its reversion in castor
17.	Construction of genetic linkage map and identification of QTL's linked to stem rot resistance in groundnut.
18.	Genome and transcriptome sequencing of coriander (Coriandrum sativum) to reveal insight of its genomic architecture and breeding targets

New technical programmes proposed (2020-21)

Sr. No.	Title
1.	Development of nanoparticles labelled immuno-strip for rapid detection of aflatoxin in groundnut.
2.	QTL mapping and identification of markers linked to salinity tolerance in chickpea (Cicer arietinum L.).
3.	Improvement of Groundnut oil quality for high oleic acid through CRISPR/Cas gene editing technology
4.	Improvement of tomato genotype for high lycopene content and delayed fruit ripening using CRISPR-Cas genome editing technology
5.	Characterization of transcription factors (TFs) involved in ABA dependent signal transduction in Peanut

New technical programmes proposed (2021-22)

Sr. No.	Title
	Nutritional, antinutritional and molecular characterization of selected genotypes of chickpea.
	Improvement of antioxidant and defense properties of Tomato using Bacillus spp.

New technical programmes proposed (2022-23)

1.	Marker-assisted backcrossing to develop foliar disease-resistant genotypes in GJG-22 variety of peanut ( Arachis hypogaea L.)
2.	Molecular characterization of sesame genotypes using SRAP markers

Projects Completed

Sr. No.	Title	PI & Co-PI	Grant (Rs. lakh)	Duration
1.	Mappingofmarine fish biodiversity usingmtDNA barcoding.	Dr. Rukam Singh Tomar (Co-PI)	19.68	2013-14 to 2015-16
2.	Evaluation of fishmeal substitution with plant proteinsinformulated feedin rohu through nutrigenomics approach.	Dr. Rukam Singh Tomar (Co-PI)	14.65	2013-14 to 2015-16
3.	Biochemical and molecular characterization of BasillusSpp. Isolated from Rhizosphere of plant and their biochemical potentials against Fusarium oxysporum f. Sp.Cumini. B.H. 18024-11	Dr. H. P. Gajera Associate Professor (PI)	14.50	2014-15 to 2016-17
4.	Transcriptome and Proteomic characterization for identification of candidate gene responsible for pistillate inflorescence and its reversion in castorB/H: 2030-07	R. S. Tomar (PI)	65.00	2015-16 to 2017-18
5.	Transcriptome analysis in coriander for identification of candidate genes against stem gall disease. B/H:2030-08	R. S. Tomar (PI)	35.20	2015-16 to 2017-18
6.	Genome andtranscriptome sequencingofcumin toreveal insight of itsgenomic architecture.	Dr. Rukam Singh Tomar (PI)	34.65	2015 to 2017
7.	Synthesis and characterization of chitosan based NPK-Nano fertilizers (18024-12)	Dr. H. P. Gajera (PI)	4.12	2017-18 to 2019-20
8.	Genome and transcriptome sequencing of coriander (Coriandrum sativum) to reveal insight its genomic architecture and breeding targets (18024-13)	Dr. R. S. Tomar (PI)	25.41	2017-18 to 2019-20
9.	To identify the Candidate biocontrol agent putatively involved in biocontrol of plant disease (18024-14)	Prof. M. V. Parakhia (PI)	6.00	2018-19 to 2019-20

Any other relevant information related to department

Awards/Recognition Received by Faculty (During years 2015-16 to 31 Aug-2020 year-wise)

Sr. No.	Name of Faculty	Name of Award	Authority	Year
Year 2015-16
	Dr. H. P. Gajera	Best Teacher Award	College of Agriculture, JAU, Junagadh	2015-16
	Dr. S. B. Bhatt	1000 samples of Soil analysis completed by 4h, 25min and 40sec. Nominate forLimca Book of World Record	Limca Book of World Record	2016-17
	V. B. Rathod	1000 samples of Soil analysis completed by 4h, 25min and 40sec. Nominate for Limca Book of World Record	Limca Book of World Record	2016-17
Year 2016-17
	Dr. R. S. Tomar	Best Teacher Award	College of Agriculture, JAU, Junagadh	2016-17
	Dr. S. B. Bhatt	Golden Book of World Record	Golden Book of World Records authority	2017-18
Year 2017-18
	Dr. H. P. Gajera and Dr. B. A. Golakiya	Krishi Shiksha Samman, National Award Winner Mahindra Samriddhi India Agri awards-2018 (Institute Awards for the work on nanotechnology and nanofertilizers). This is in recognition to an agricultural university for their purposeful and noteworthy contribution to the field of Agriculture, having a positive impact on the farming communities, thus enabling them to RISE	Mahindra and Mahindra Ltd., Mumbai	2017-18
	Dr. R. S. Tomar	Dr. V. P. Gokhale Award	Maharashtra Association for the Cultivation of Science, Pune	2017-18
	Dr. R. S. Tomar	Best Researcher Award	IRDP Group, 2/5, Krishna Industrial Estate, Mettukuppam, Vanagaram, Chennai- 600095, Tamil Nadu, India.	2017-18
	Dr. S. B. Bhatt	Best Young Faculty Award in the field of Biotechnology	Education Expo EET,CRS	2017-18
	Dr. S. B. Bhatt	Best Young Women Scientist Award	Samagra Vikas Welfare Society, Lucknow	2017-18
Year 2018-19
	Dr. H. P. Gajera	Dr. Sarvapalli Radhakrishnan life time achievement award for Teaching, Research and Publications	IRDP Group of Journals, Chennai	2018-19
	Dr. H. P. Gajera	Teaching and Research Excellence National Award	IRDP Group of Journals, Chennai	2018-19
	Dr. U. K. Kandoliya	Dr. Sarvapalli Radhakrishnan life time achievement award for Teaching, Research and Publications	IRDP Group of Journals, Chennai- 600095, Tamil Nadu, India.	2018-19
	Dr. Manoj V. Parakhia	Best Scientist National Award	IRDP, group of journals	2018-19
	Dr. Manoj V. Parakhia	Young Scientist Award	Samagra Vikas Welfare Society (SVWS)	2018-19
	Dr. Rukam Singh Tomar	Young Scientist Award	SamagraVikas Welfare Society	2018-19
Year 2019-20
	Dr. Manoj V. Parakhia	Young Achiever Award	Institute of Scholars (InSc), Bangalore	2019-20
	Dr. Manoj V. Parakhia	Teacher Innovation Award	Zero-Investment Innovations for education Initiatives (ZIIEI)	2019-20
	Dr. Rukam Singh Tomar	Outstanding Researcher Award	Aufau Science Forum and Chemical Science Review and Letters, Salem, India.	2019-20
Year 2021-22
	Dr. Manoj V. Parakhia	Best Faculty	Education Expo EET,CRS	2021-22
Year 2022-23
	Dr S B Bhatt	Academic Excellence Award	Institute of Scholars	2023
	Dr S B Bhatt	Young Researcher Award	Institute of Scholars	2023
Year 2023-24
	Dr S B Bhatt	Senior Scientist Award –Gujarat State	Microbiology society of India	2024

Awards Received by PG Students (During years 2015-16 to 31 Aug-2020 year-wise)

Sr. No.	Name of Student	Name of Guide	Name of Award	Awardee	Year
Year 2016-17
1.	Bharose Achyut Ashokrao Ph. D. Student (Reg.No.J4-01335-2014)	Dr. H. P. Gajera	Best PG research under Agriculture category and secured First position in west zone students research convention	Anveshan – 2016 Students research convention (west zone) at Maharaja Ganga Singh University, Bikaner, Rajasthan, January 12-13, 2016	January 12-13, 2016
2.	Hirpara Darshna G. Ph. D. Student (Reg. No. 1010115007)	Dr. H. P. Gajera	Chancellor’s Gold Medal for the best overall performance in M.Sc. (Agri.) Degree	Twelth Convocation of Junagadh Agricultural University, Junagadh,	12th January 2017
3.	ThoppurathuFeba Jacob (Reg. No. 2010116121)	Dr. A. G. Vala	Vice Chancellor’s Gold Medal for the best overall performance in B.Sc. (Agri. Biotech) Degree	Twelfth Convocation of Navsari Agricultural University, Navsari	28th January 2017
4.	Suhail Ahmad A. Hakeem Ph. D. Student (Reg. No.J4-01418-2014)	Dr. H. P. Gajera	Poster Presentation	Department of Biochemistry, Saurashtra University, Rajkot	4th March 2017
5.	Parmar Krupalkumar A. M.Sc. Student (Reg. No. 2010116087)	Dr. P. J. Rathod	Poster Presentation	Christ College, Rajkot,	February 26 & 27,2017
6.	Jasminkumar V. Kheni Ph. D. Student (Reg. No.J4-01151-2013)	Dr. B. A. Golakiya	Young Scientist	Mehsana Urban Institute of Science, Ganpat University, Mehsana, Gujarat, India	2017
7.	Hirpara Darshna G. Ph. D. Student (Reg. No. 1010115007)	Dr. H. P. Gajera	Young Scientist	Samagra Vikash Welfare Society & Bharatiy Cine Karmachari Sangh, Lucknow	2017
Year 2017-18
1.	Suhail Ahmad A Hakeem Ph. D. Student (Reg. No.J4-01418-2014)	Dr. H. P. Gajera	Best oral research presentation in the subject of Biotechnology	10th National Science Symposium on "Recent Trends in Science and Technology" at Christ College, Rajkot	February 10, 2018
Year 2018-19
1.	Hirpara Darshna G. Ph. D. Student (Reg. No. 1010115007)	Dr. H. P. Gajera	Prestigious IRDP Awards - 2018 (Sir C. V. Raman Life Time Achievement National Award)	IRDP Group of Journals, #2/5, Krishna Industrial Estate, Mettukuppam, Vanagaram, Chennai-600095	2018
2.	Savaliya Disha D. Ph. D. Student (Reg. No. J4-00408-2008)	Dr. M. K. Mandavia	Prestigious IRDP Awards - 2018 (Best Young Researcher National Award)	IRDP Group of Journals, #2/5, Krishna Industrial Estate, Mettukuppam, Vanagaram, Chennai-600095	2018
3.	Suhail Ahmad A Hakeem Ph. D. Student (Reg. No.J4-01418-2014)	Dr. H. P. Gajera	Best oral presentation (Second prize)	National conference on "Enhancing productivity of oilseeds in changing climate scenario" at ICAR-Directorate of Groundnut Research, Junagadh	April 7-9, 2018
Year 2020-21
1.	Hirpara Darshna G. Ph. D. Student (Reg. No. 1010115007)	Dr. H. P. Gajera	ICAR National Award - 2019: Jawaharlal Nehru Award for Outstanding Doctoral Thesis Research in Agricultural and Allied Sciences 2019 in the category of Biotechnology	92nd foundation day of ICAR and award ceremony at Indian Council of Agricultural Research (ICAR), New Delhi	July 16, 2020
2.	Savani Khyati R. (Reg. No. 1010115007) Ph. D. Student 2021-2023	Dr. H. P. Gajera	Award for Prime Minister’s Fellowship for Doctoral Research Title of Ph. D.Thesis Transcriptome and biochemical depictions of developing anther influenced by salicylic acid functionalized nanochitosan under heat stress in cotton (Gossypium hirsutum L.)	A PPP Initiative of Science & Engineering Research Board (SERB) Department of Science & Technology, Government of India and Confederation of Indian Industry (CII)	2021-2023
Year 2021-22
1.	Bhadani Rushita V. (Reg. No. 1010117002) Ph. D. (Agri.) PMBB	Dr. H. P. Gajera	Dr. A. V. Barad´s Late Parents Smt. Amarba & Shri Virsangbhai barad Memorial Gold Plated Silver medal for securing highest overall grade point average in faculty of Agriculture or Horticulture in Doctoral Degree	Junagadh Agriculture University, Junagadh	8th Jan, 2022
2.	Savani Khyati R. (Reg. No. 1010115007) PMBB	Dr. H. P. Gajera	2nd position for oral presentation of research paper entitled “Metabolomics of developing anthers and sepals influenced by salicylic acid functionalized nano-chitosan particles to attenuate damage	International Conference on Biotechnological Initiative for climate resilient Agriculture at RPCAU, PUSA, Bihar	Jan 7-9th, 2022
Year 2022-23
1.	Hirpara Darshna Gordhanbhai (1010115007) Ph. D. (PMBB)	Dr. H. P. Gajera	Best Ph. D. thesis award – 2018 & 2019:	The Gujarat Association for Agricultural Sciences (GAAS), Ahmedabad Held at Gujarat Vidyapith, Ahmedabad	2nd February, 2023
2.	Hirpara Darshna Gordhanbhai (1010115007) Ph. D. (PMBB)	Dr. H. P. Gajera	Shri Chaitanya Mehta Award -2020: For Commendable presentation of Ph. D. Thesis work sponsored by Dr. K. G. Mehta, Ahmedabad	The Gujarat Association for Agricultural Sciences (GAAS), Ahmedabad Held at Gujarat Vidyapith, Ahmedabad	2nd February, 2023
3.	Hirpara Darshna Gordhanbhai (1010115007) Ph. D. (PMBB)	Dr. H. P. Gajera	Best oral presentation - first prize	National Conference on “Emerging Paradigm in Agricultural Microbiology” held on February 11th, 2023 at Atmiya University, Rajkot.	February 11th, 2023

College of Agriculture

Visitors Counter